Incidental Mutation 'R6434:Herc1'
ID518705
Institutional Source Beutler Lab
Gene Symbol Herc1
Ensembl Gene ENSMUSG00000038664
Gene NameHECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonymstbl, D130015N03Rik, 2810449H11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6434 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location66350450-66508775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66486182 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 4114 (H4114Q)
Ref Sequence ENSEMBL: ENSMUSP00000044801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042824]
Predicted Effect probably damaging
Transcript: ENSMUST00000042824
AA Change: H4114Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044801
Gene: ENSMUSG00000038664
AA Change: H4114Q

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:RCC1 476 526 5.4e-15 PFAM
Pfam:RCC1_2 513 542 1.3e-9 PFAM
Pfam:RCC1 529 576 5.5e-16 PFAM
Pfam:RCC1 579 629 1.5e-10 PFAM
Pfam:RCC1 632 680 3.6e-9 PFAM
Pfam:RCC1_2 667 696 2.2e-11 PFAM
Pfam:RCC1 683 733 1.2e-14 PFAM
low complexity region 787 807 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
low complexity region 1080 1100 N/A INTRINSIC
low complexity region 1348 1378 N/A INTRINSIC
low complexity region 1659 1676 N/A INTRINSIC
low complexity region 1865 1874 N/A INTRINSIC
low complexity region 2002 2030 N/A INTRINSIC
SPRY 2067 2188 1.8e-30 SMART
coiled coil region 2251 2280 N/A INTRINSIC
low complexity region 2410 2423 N/A INTRINSIC
low complexity region 2613 2629 N/A INTRINSIC
low complexity region 2633 2648 N/A INTRINSIC
low complexity region 2650 2667 N/A INTRINSIC
low complexity region 2736 2749 N/A INTRINSIC
low complexity region 2882 2896 N/A INTRINSIC
low complexity region 2924 2935 N/A INTRINSIC
low complexity region 2971 2987 N/A INTRINSIC
low complexity region 3045 3051 N/A INTRINSIC
low complexity region 3168 3186 N/A INTRINSIC
low complexity region 3191 3213 N/A INTRINSIC
low complexity region 3364 3379 N/A INTRINSIC
WD40 3415 3454 1.68e-6 SMART
WD40 3570 3608 3.68e1 SMART
WD40 3613 3652 4.3e-1 SMART
WD40 3657 3702 3.17e-2 SMART
WD40 3734 3773 8.29e-6 SMART
low complexity region 3950 3964 N/A INTRINSIC
Pfam:RCC1_2 4079 4111 7.3e-9 PFAM
Pfam:RCC1 4098 4147 3.4e-16 PFAM
Pfam:RCC1_2 4134 4163 1.8e-7 PFAM
Pfam:RCC1 4150 4199 7.2e-16 PFAM
Pfam:RCC1 4204 4252 6.1e-12 PFAM
Pfam:RCC1 4255 4304 2.4e-7 PFAM
Pfam:RCC1_2 4291 4320 5.8e-12 PFAM
Pfam:RCC1 4307 4356 8.9e-16 PFAM
Blast:HECTc 4389 4423 2e-11 BLAST
HECTc 4497 4846 8.2e-148 SMART
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gen encodes a member of the HERC protein family. This protein stimulates guanine nucleotide exchange on ARF1 and Rab proteins. This protein may be involved in membrane transport processes. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for this spontaneous mutation exhibit an abnormal cerebellar Purkinje cell layer and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam A C 16: 52,288,827 probably null Het
Ankle2 A G 5: 110,253,893 Y807C probably damaging Het
Arhgef26 A C 3: 62,428,914 M625L probably damaging Het
Aspdh G A 7: 44,467,050 A86T probably damaging Het
Atl1 G T 12: 69,959,425 E502* probably null Het
Atp6v1c1 T C 15: 38,677,546 F105S probably damaging Het
Auh C A 13: 52,929,410 G17C probably benign Het
Ccdc130 A G 8: 84,263,001 I63T probably damaging Het
Ccdc81 T C 7: 89,876,144 Y474C probably damaging Het
Ccdc82 T C 9: 13,252,034 probably benign Het
Ccdc96 T G 5: 36,486,363 V571G probably damaging Het
Col6a5 C A 9: 105,937,345 E489D unknown Het
Dchs2 T A 3: 83,269,270 I845N probably damaging Het
Dnajc11 T C 4: 151,979,294 V449A probably damaging Het
Ect2 A T 3: 27,139,119 Y269* probably null Het
Egfr T C 11: 16,869,294 Y275H probably benign Het
Fan1 T A 7: 64,354,381 D779V probably damaging Het
Fancm T C 12: 65,077,168 V200A probably damaging Het
Frem1 A G 4: 82,966,016 I1214T probably benign Het
Gm3415 T A 5: 146,557,942 F138L probably benign Het
Gtse1 C A 15: 85,875,169 T626K probably benign Het
Ifi44 T A 3: 151,749,189 N133I probably benign Het
Ilf3 A G 9: 21,403,151 probably benign Het
Inpp4a A G 1: 37,398,838 T593A probably damaging Het
Iqgap2 A T 13: 95,682,933 W634R possibly damaging Het
Kcnh4 T A 11: 100,750,279 N448I probably damaging Het
Klhl33 G A 14: 50,893,107 A310V probably damaging Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Lrig2 T C 3: 104,491,547 K222E possibly damaging Het
Manba G A 3: 135,511,973 probably null Het
Mga A T 2: 119,923,938 Q976L probably damaging Het
Mtmr4 A G 11: 87,613,483 D1086G probably damaging Het
Muc20 A G 16: 32,794,806 V67A probably benign Het
Myh3 T A 11: 67,082,367 L97Q probably damaging Het
Nars T C 18: 64,507,801 T195A probably benign Het
Npat A T 9: 53,563,439 I844L possibly damaging Het
Nrxn3 T C 12: 88,795,515 F111L probably benign Het
Obp2b T C 2: 25,738,587 Y118H probably damaging Het
Olfr1134 T A 2: 87,656,214 K236* probably null Het
Olfr862 A T 9: 19,883,845 Y153* probably null Het
Patj A G 4: 98,491,629 D215G probably damaging Het
Pex1 T A 5: 3,630,196 Y979* probably null Het
Sept3 G A 15: 82,279,603 V54I possibly damaging Het
Shc3 A G 13: 51,449,290 Y260H probably damaging Het
Simc1 A G 13: 54,526,664 T942A probably benign Het
Slco1c1 T C 6: 141,547,850 S371P probably damaging Het
Snrnp200 T A 2: 127,238,654 I2029N probably damaging Het
Syne1 A G 10: 5,318,422 V2089A probably benign Het
Syne2 T C 12: 76,041,456 S5016P probably damaging Het
Tril G C 6: 53,818,508 D576E probably damaging Het
Tubb2b C T 13: 34,127,578 A411T probably damaging Het
Ubr4 T C 4: 139,429,638 Y2325H probably damaging Het
Utp20 A T 10: 88,772,533 C1547* probably null Het
Utrn A T 10: 12,525,427 W98R probably damaging Het
Vps35 C T 8: 85,273,495 D501N possibly damaging Het
Wdr48 T C 9: 119,916,813 S421P possibly damaging Het
Zfp719 C A 7: 43,590,988 H667N probably damaging Het
Other mutations in Herc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Herc1 APN 9 66483966 missense probably benign 0.02
IGL00159:Herc1 APN 9 66437682 missense possibly damaging 0.94
IGL00486:Herc1 APN 9 66476120 missense probably benign
IGL00717:Herc1 APN 9 66485002 missense probably damaging 1.00
IGL00766:Herc1 APN 9 66450741 missense probably damaging 1.00
IGL00776:Herc1 APN 9 66421038 missense probably benign
IGL00987:Herc1 APN 9 66408052 missense probably benign 0.07
IGL01090:Herc1 APN 9 66469175 nonsense probably null
IGL01098:Herc1 APN 9 66461922 critical splice donor site probably null
IGL01106:Herc1 APN 9 66476438 splice site probably benign
IGL01120:Herc1 APN 9 66428880 missense probably benign
IGL01359:Herc1 APN 9 66439268 missense probably benign 0.01
IGL01360:Herc1 APN 9 66483699 missense probably benign
IGL01364:Herc1 APN 9 66399361 missense probably benign 0.00
IGL01470:Herc1 APN 9 66497636 missense possibly damaging 0.94
IGL01670:Herc1 APN 9 66487060 missense probably damaging 1.00
IGL01825:Herc1 APN 9 66399807 missense probably benign 0.00
IGL01903:Herc1 APN 9 66386872 nonsense probably null
IGL01988:Herc1 APN 9 66488075 splice site probably benign
IGL02074:Herc1 APN 9 66450983 missense probably benign
IGL02089:Herc1 APN 9 66480869 missense probably damaging 1.00
IGL02177:Herc1 APN 9 66434511 missense probably benign
IGL02300:Herc1 APN 9 66476363 missense probably benign 0.01
IGL02304:Herc1 APN 9 66476414 missense probably benign 0.06
IGL02369:Herc1 APN 9 66492011 nonsense probably null
IGL02445:Herc1 APN 9 66433482 missense possibly damaging 0.95
IGL02447:Herc1 APN 9 66497328 missense possibly damaging 0.59
IGL02549:Herc1 APN 9 66399901 missense probably damaging 0.98
IGL02571:Herc1 APN 9 66434605 splice site probably benign
IGL02709:Herc1 APN 9 66497680 missense probably damaging 0.97
IGL02717:Herc1 APN 9 66371921 nonsense probably null
IGL02726:Herc1 APN 9 66441988 missense probably benign 0.37
IGL02733:Herc1 APN 9 66450992 missense probably benign
IGL02963:Herc1 APN 9 66388823 missense probably damaging 0.99
IGL03101:Herc1 APN 9 66487997 missense probably benign
IGL03193:Herc1 APN 9 66402680 missense probably benign
IGL03203:Herc1 APN 9 66388900 critical splice donor site probably null
IGL03216:Herc1 APN 9 66478946 missense probably benign 0.06
IGL03282:Herc1 APN 9 66451459 missense probably benign 0.05
IGL03295:Herc1 APN 9 66396703 missense possibly damaging 0.56
IGL03134:Herc1 UTSW 9 66434063 critical splice acceptor site probably benign
PIT4243001:Herc1 UTSW 9 66372207 missense probably benign 0.00
PIT4486001:Herc1 UTSW 9 66372389 missense probably damaging 1.00
PIT4696001:Herc1 UTSW 9 66479009 missense probably damaging 1.00
R0044:Herc1 UTSW 9 66448175 missense probably benign 0.04
R0044:Herc1 UTSW 9 66448175 missense probably benign 0.04
R0052:Herc1 UTSW 9 66400156 missense probably damaging 0.99
R0114:Herc1 UTSW 9 66461846 missense probably damaging 0.99
R0129:Herc1 UTSW 9 66448075 missense probably damaging 1.00
R0131:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0131:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0132:Herc1 UTSW 9 66480910 missense probably benign 0.00
R0158:Herc1 UTSW 9 66495921 nonsense probably null
R0333:Herc1 UTSW 9 66464699 splice site probably null
R0384:Herc1 UTSW 9 66481050 splice site probably benign
R0419:Herc1 UTSW 9 66446074 splice site probably benign
R0453:Herc1 UTSW 9 66399772 missense probably benign 0.20
R0458:Herc1 UTSW 9 66476381 missense probably benign 0.12
R0490:Herc1 UTSW 9 66484999 missense probably damaging 1.00
R0506:Herc1 UTSW 9 66448159 missense probably damaging 0.99
R0513:Herc1 UTSW 9 66445645 missense possibly damaging 0.96
R0628:Herc1 UTSW 9 66450881 missense probably benign 0.35
R0666:Herc1 UTSW 9 66484888 splice site probably benign
R0674:Herc1 UTSW 9 66501192 missense probably damaging 0.99
R0682:Herc1 UTSW 9 66481981 missense possibly damaging 0.95
R0690:Herc1 UTSW 9 66386838 nonsense probably null
R0701:Herc1 UTSW 9 66487950 missense probably damaging 1.00
R0766:Herc1 UTSW 9 66504840 missense probably damaging 1.00
R0850:Herc1 UTSW 9 66466670 missense probably damaging 1.00
R0907:Herc1 UTSW 9 66433428 missense possibly damaging 0.94
R0972:Herc1 UTSW 9 66372145 missense probably damaging 1.00
R0976:Herc1 UTSW 9 66439878 missense possibly damaging 0.74
R1027:Herc1 UTSW 9 66455968 missense probably benign
R1200:Herc1 UTSW 9 66486124 missense probably damaging 1.00
R1226:Herc1 UTSW 9 66416263 missense probably benign 0.00
R1364:Herc1 UTSW 9 66400093 missense probably damaging 1.00
R1395:Herc1 UTSW 9 66439181 missense probably benign 0.13
R1432:Herc1 UTSW 9 66465469 missense probably benign 0.13
R1440:Herc1 UTSW 9 66467803 missense probably damaging 1.00
R1476:Herc1 UTSW 9 66508266 missense probably damaging 1.00
R1590:Herc1 UTSW 9 66491953 splice site probably benign
R1634:Herc1 UTSW 9 66473538 missense possibly damaging 0.51
R1700:Herc1 UTSW 9 66450678 unclassified probably null
R1753:Herc1 UTSW 9 66469010 missense probably damaging 1.00
R1753:Herc1 UTSW 9 66502084 critical splice donor site probably null
R1796:Herc1 UTSW 9 66388856 nonsense probably null
R1830:Herc1 UTSW 9 66497599 missense possibly damaging 0.95
R1855:Herc1 UTSW 9 66391426 missense possibly damaging 0.95
R1866:Herc1 UTSW 9 66450791 missense probably damaging 1.00
R1894:Herc1 UTSW 9 66479461 missense probably damaging 1.00
R1918:Herc1 UTSW 9 66476126 splice site probably null
R1999:Herc1 UTSW 9 66486078 missense probably benign 0.07
R2034:Herc1 UTSW 9 66441972 missense probably benign 0.01
R2138:Herc1 UTSW 9 66470307 missense possibly damaging 0.94
R2186:Herc1 UTSW 9 66439901 missense probably benign 0.45
R2192:Herc1 UTSW 9 66465406 missense probably damaging 0.99
R2312:Herc1 UTSW 9 66508281 nonsense probably null
R2338:Herc1 UTSW 9 66428969 missense possibly damaging 0.69
R3035:Herc1 UTSW 9 66483935 missense possibly damaging 0.89
R3732:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3732:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3733:Herc1 UTSW 9 66445640 missense probably damaging 1.00
R3917:Herc1 UTSW 9 66434466 missense possibly damaging 0.94
R3953:Herc1 UTSW 9 66433793 nonsense probably null
R4073:Herc1 UTSW 9 66418492 missense probably benign 0.12
R4075:Herc1 UTSW 9 66418492 missense probably benign 0.12
R4241:Herc1 UTSW 9 66448348 frame shift probably null
R4260:Herc1 UTSW 9 66448348 frame shift probably null
R4261:Herc1 UTSW 9 66448348 frame shift probably null
R4300:Herc1 UTSW 9 66489406 missense probably damaging 1.00
R4398:Herc1 UTSW 9 66479453 missense probably benign 0.13
R4426:Herc1 UTSW 9 66496005 missense probably damaging 1.00
R4427:Herc1 UTSW 9 66496005 missense probably damaging 1.00
R4590:Herc1 UTSW 9 66437664 missense probably damaging 0.97
R4630:Herc1 UTSW 9 66433714 splice site probably null
R4656:Herc1 UTSW 9 66394711 missense probably damaging 0.97
R4658:Herc1 UTSW 9 66479491 missense possibly damaging 0.50
R4663:Herc1 UTSW 9 66433378 missense probably damaging 0.98
R4675:Herc1 UTSW 9 66391458 missense probably damaging 1.00
R4678:Herc1 UTSW 9 66416269 missense probably benign 0.00
R4754:Herc1 UTSW 9 66501206 missense probably benign 0.00
R4766:Herc1 UTSW 9 66441929 missense probably benign 0.00
R4792:Herc1 UTSW 9 66495984 missense possibly damaging 0.67
R4828:Herc1 UTSW 9 66497343 splice site probably null
R4832:Herc1 UTSW 9 66495971 missense probably benign 0.11
R4879:Herc1 UTSW 9 66462837 nonsense probably null
R4948:Herc1 UTSW 9 66484902 missense probably benign
R5021:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5022:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5023:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5024:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5025:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5026:Herc1 UTSW 9 66486126 missense probably benign 0.03
R5027:Herc1 UTSW 9 66473529 missense probably benign 0.01
R5027:Herc1 UTSW 9 66504618 missense probably damaging 0.98
R5038:Herc1 UTSW 9 66476460 intron probably benign
R5041:Herc1 UTSW 9 66429045 missense possibly damaging 0.86
R5053:Herc1 UTSW 9 66470326 missense possibly damaging 0.48
R5137:Herc1 UTSW 9 66448223 missense probably benign
R5197:Herc1 UTSW 9 66448504 missense probably damaging 0.99
R5207:Herc1 UTSW 9 66399869 nonsense probably null
R5247:Herc1 UTSW 9 66434551 missense probably benign 0.01
R5267:Herc1 UTSW 9 66461809 missense probably damaging 1.00
R5274:Herc1 UTSW 9 66399409 missense probably benign
R5375:Herc1 UTSW 9 66467887 missense probably damaging 0.99
R5401:Herc1 UTSW 9 66502056 missense probably damaging 1.00
R5560:Herc1 UTSW 9 66451119 missense probably benign 0.02
R5566:Herc1 UTSW 9 66465537 missense possibly damaging 0.95
R5577:Herc1 UTSW 9 66481981 missense probably damaging 0.99
R5596:Herc1 UTSW 9 66434063 critical splice acceptor site probably benign
R5665:Herc1 UTSW 9 66465435 missense probably damaging 1.00
R5744:Herc1 UTSW 9 66508193 missense probably damaging 1.00
R5802:Herc1 UTSW 9 66462878 missense probably damaging 1.00
R5822:Herc1 UTSW 9 66445612 missense probably benign 0.00
R5954:Herc1 UTSW 9 66451492 splice site probably benign
R5977:Herc1 UTSW 9 66433322 missense possibly damaging 0.77
R6022:Herc1 UTSW 9 66483685 missense probably damaging 1.00
R6043:Herc1 UTSW 9 66408154 missense probably benign
R6046:Herc1 UTSW 9 66445549 missense probably damaging 0.99
R6089:Herc1 UTSW 9 66445532 missense probably damaging 1.00
R6123:Herc1 UTSW 9 66497250 missense probably damaging 0.97
R6155:Herc1 UTSW 9 66433423 missense possibly damaging 0.95
R6190:Herc1 UTSW 9 66376381 missense possibly damaging 0.56
R6220:Herc1 UTSW 9 66433788 missense probably damaging 1.00
R6265:Herc1 UTSW 9 66372016 missense probably benign 0.05
R6348:Herc1 UTSW 9 66487976 missense possibly damaging 0.77
R6362:Herc1 UTSW 9 66471908 missense probably damaging 1.00
R6394:Herc1 UTSW 9 66395059 missense probably damaging 0.99
R6483:Herc1 UTSW 9 66448529 missense possibly damaging 0.64
R6607:Herc1 UTSW 9 66418567 missense probably benign 0.02
R6633:Herc1 UTSW 9 66439252 nonsense probably null
R6634:Herc1 UTSW 9 66437744 missense probably benign
R6693:Herc1 UTSW 9 66478976 missense probably damaging 0.99
R6695:Herc1 UTSW 9 66483866 splice site probably null
R6748:Herc1 UTSW 9 66501188 frame shift probably null
R6750:Herc1 UTSW 9 66501188 frame shift probably null
R6751:Herc1 UTSW 9 66501188 frame shift probably null
R6774:Herc1 UTSW 9 66501188 frame shift probably null
R6785:Herc1 UTSW 9 66501188 frame shift probably null
R6786:Herc1 UTSW 9 66501188 frame shift probably null
R6856:Herc1 UTSW 9 66397898 missense probably benign 0.05
R6966:Herc1 UTSW 9 66411065 missense probably benign 0.07
R7020:Herc1 UTSW 9 66486078 missense probably benign 0.07
R7109:Herc1 UTSW 9 66481889 missense probably benign 0.03
R7122:Herc1 UTSW 9 66399774 missense possibly damaging 0.69
R7209:Herc1 UTSW 9 66385032 missense possibly damaging 0.95
R7222:Herc1 UTSW 9 66467499 missense probably damaging 0.98
R7303:Herc1 UTSW 9 66450816 missense possibly damaging 0.93
R7305:Herc1 UTSW 9 66461868 missense
X0011:Herc1 UTSW 9 66400159 missense probably benign 0.28
X0067:Herc1 UTSW 9 66448524 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTTTCTTAGTAGCTGCAAGAGTGAC -3'
(R):5'- TGAGCTGAGCCGACATAGTG -3'

Sequencing Primer
(F):5'- GTAGCTGCAAGAGTGACTATTTATC -3'
(R):5'- AGTGGATCGCTTATACTACTGC -3'
Posted On2018-05-24