Incidental Mutation 'R6633:Plekhb1'
ID525302
Institutional Source Beutler Lab
Gene Symbol Plekhb1
Ensembl Gene ENSMUSG00000030701
Gene Namepleckstrin homology domain containing, family B (evectins) member 1
SynonymsPHR1, Phret1, evt-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6633 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location100642892-100662414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100645639 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 122 (Y122H)
Ref Sequence ENSEMBL: ENSMUSP00000116888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032946] [ENSMUST00000079176] [ENSMUST00000098252] [ENSMUST00000107043] [ENSMUST00000107044] [ENSMUST00000107045] [ENSMUST00000107046] [ENSMUST00000107047] [ENSMUST00000107048] [ENSMUST00000116287] [ENSMUST00000138830] [ENSMUST00000139708] [ENSMUST00000151123]
Predicted Effect probably benign
Transcript: ENSMUST00000032946
SMART Domains Protein: ENSMUSP00000032946
Gene: ENSMUSG00000030704

DomainStartEndE-ValueType
RAB 14 177 6.24e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079176
AA Change: Y176H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078175
Gene: ENSMUSG00000030701
AA Change: Y176H

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 216 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098252
SMART Domains Protein: ENSMUSP00000095852
Gene: ENSMUSG00000030704

DomainStartEndE-ValueType
RAB 14 177 5.52e-90 SMART
Predicted Effect silent
Transcript: ENSMUST00000107043
SMART Domains Protein: ENSMUSP00000102658
Gene: ENSMUSG00000030701

DomainStartEndE-ValueType
PDB:2D9V|A 2 103 1e-68 PDB
SCOP:d1dbha2 3 97 7e-12 SMART
Blast:PH 3 103 9e-67 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107044
AA Change: Y122H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102659
Gene: ENSMUSG00000030701
AA Change: Y122H

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 162 183 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107045
AA Change: Y157H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102660
Gene: ENSMUSG00000030701
AA Change: Y157H

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 197 218 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107046
AA Change: Y122H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102661
Gene: ENSMUSG00000030701
AA Change: Y122H

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 162 183 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107047
AA Change: Y141H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102662
Gene: ENSMUSG00000030701
AA Change: Y141H

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 181 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107048
SMART Domains Protein: ENSMUSP00000102663
Gene: ENSMUSG00000030704

DomainStartEndE-ValueType
RAB 1 144 2.57e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116287
AA Change: Y157H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111991
Gene: ENSMUSG00000030701
AA Change: Y157H

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 197 218 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135255
Predicted Effect probably damaging
Transcript: ENSMUST00000138830
AA Change: Y122H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116888
Gene: ENSMUSG00000030701
AA Change: Y122H

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139708
AA Change: Y122H

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122333
Gene: ENSMUSG00000030701
AA Change: Y122H

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151123
AA Change: Y176H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115559
Gene: ENSMUSG00000030701
AA Change: Y176H

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 216 237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable with no abnormalities detected in growth, behavior including balance, inner ear histology, or serum and urine electrolyte concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf C A 11: 84,511,482 probably null Het
Acot7 C T 4: 152,178,259 P30L probably benign Het
Adam24 T G 8: 40,680,487 D331E probably benign Het
Adamdec1 T C 14: 68,573,152 D185G probably benign Het
Adgrg7 T C 16: 56,730,286 I688V probably benign Het
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Agtr1a A G 13: 30,381,467 I172V probably benign Het
Anapc4 C T 5: 52,865,946 H710Y possibly damaging Het
Arf1 T C 11: 59,212,544 N179S probably benign Het
Arhgef40 C T 14: 51,997,431 P1064S probably damaging Het
Btnl1 A G 17: 34,385,331 N362S possibly damaging Het
Ccdc80 T C 16: 45,094,908 F9S possibly damaging Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cdh2 A T 18: 16,640,548 N241K probably benign Het
Cdk8 C A 5: 146,298,846 S261* probably null Het
Csf2rb2 T C 15: 78,288,952 E236G probably benign Het
Dgcr8 A T 16: 18,284,182 S79T possibly damaging Het
Dnah5 A T 15: 28,293,787 Y1346F probably benign Het
Dock6 A G 9: 21,820,331 V1194A probably benign Het
Dock6 A G 9: 21,821,503 S1129P probably damaging Het
Ephb2 C G 4: 136,683,996 S451T probably benign Het
Esco1 T A 18: 10,595,738 probably benign Het
Fcer1a C G 1: 173,226,726 probably null Het
Gbx2 TCCCCC TCCCCCC 1: 89,928,720 probably null Het
Gm44511 T A 6: 128,826,242 D2V probably damaging Het
H2-Q2 A G 17: 35,342,387 T19A probably damaging Het
Herc1 G T 9: 66,439,252 E1967* probably null Het
Hic1 G T 11: 75,169,498 H8N unknown Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Jarid2 C A 13: 44,884,877 H84N probably damaging Het
Klk1b27 A T 7: 44,055,810 I134F probably damaging Het
Kprp T C 3: 92,825,293 Y150C probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp10 T C 14: 54,469,074 V489A probably benign Het
Mrgpra6 A G 7: 47,188,745 I235T possibly damaging Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Olfr1259 T C 2: 89,943,366 I250V probably benign Het
Plcl2 A G 17: 50,640,140 I1016V probably benign Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Rag1 T A 2: 101,642,710 R696W probably damaging Het
Rusc2 T C 4: 43,414,852 F53L probably damaging Het
Tango6 T C 8: 106,718,005 V514A probably benign Het
Tex30 A C 1: 44,087,924 H64Q probably benign Het
Tmbim7 A G 5: 3,657,659 probably null Het
Tmem5 G A 10: 122,097,053 R7W probably damaging Het
Tpcn1 A G 5: 120,544,464 M493T probably benign Het
Tpx2 T G 2: 152,867,354 F35V probably damaging Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Wnt2b T C 3: 104,951,056 Y299C probably damaging Het
Other mutations in Plekhb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Plekhb1 APN 7 100655299 missense probably damaging 1.00
F5770:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
R0722:Plekhb1 UTSW 7 100645603 missense probably damaging 1.00
R1891:Plekhb1 UTSW 7 100655392 missense probably damaging 1.00
R3427:Plekhb1 UTSW 7 100645650 missense probably damaging 1.00
R5506:Plekhb1 UTSW 7 100644943 unclassified probably null
R5695:Plekhb1 UTSW 7 100655395 missense probably damaging 1.00
R5696:Plekhb1 UTSW 7 100656753 missense probably damaging 1.00
R5789:Plekhb1 UTSW 7 100645586 nonsense probably null
R7304:Plekhb1 UTSW 7 100645667 missense probably benign 0.19
V7580:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
V7582:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
V7583:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CCCGGAGAGTCTGTTTTGAATC -3'
(R):5'- AAGGCATTATTGGGAGCTGG -3'

Sequencing Primer
(F):5'- CTGCAAAATATGTATACCCTCAAAGG -3'
(R):5'- AGCTGGATGTTTTAGGGGAGAAG -3'
Posted On2018-06-22