Incidental Mutation 'R5506:Plekhb1'
ID430923
Institutional Source Beutler Lab
Gene Symbol Plekhb1
Ensembl Gene ENSMUSG00000030701
Gene Namepleckstrin homology domain containing, family B (evectins) member 1
SynonymsPHR1, Phret1, evt-1
MMRRC Submission 043067-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5506 (G1)
Quality Score115
Status Validated
Chromosome7
Chromosomal Location100642892-100662414 bp(-) (GRCm38)
Type of Mutationunclassified (3 bp from exon)
DNA Base Change (assembly) C to A at 100644943 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032946] [ENSMUST00000079176] [ENSMUST00000098252] [ENSMUST00000107043] [ENSMUST00000107044] [ENSMUST00000107045] [ENSMUST00000107046] [ENSMUST00000107047] [ENSMUST00000107048] [ENSMUST00000116287] [ENSMUST00000138830] [ENSMUST00000139708] [ENSMUST00000151123]
Predicted Effect probably benign
Transcript: ENSMUST00000032946
SMART Domains Protein: ENSMUSP00000032946
Gene: ENSMUSG00000030704

DomainStartEndE-ValueType
RAB 14 177 6.24e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079176
AA Change: C241F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078175
Gene: ENSMUSG00000030701
AA Change: C241F

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 216 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098252
SMART Domains Protein: ENSMUSP00000095852
Gene: ENSMUSG00000030704

DomainStartEndE-ValueType
RAB 14 177 5.52e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107043
SMART Domains Protein: ENSMUSP00000102658
Gene: ENSMUSG00000030701

DomainStartEndE-ValueType
PDB:2D9V|A 2 103 1e-68 PDB
SCOP:d1dbha2 3 97 7e-12 SMART
Blast:PH 3 103 9e-67 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107044
AA Change: C187F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102659
Gene: ENSMUSG00000030701
AA Change: C187F

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 162 183 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107045
AA Change: C222F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102660
Gene: ENSMUSG00000030701
AA Change: C222F

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 197 218 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107046
AA Change: C187F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102661
Gene: ENSMUSG00000030701
AA Change: C187F

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 162 183 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107047
AA Change: C206F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102662
Gene: ENSMUSG00000030701
AA Change: C206F

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 181 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107048
SMART Domains Protein: ENSMUSP00000102663
Gene: ENSMUSG00000030704

DomainStartEndE-ValueType
RAB 1 144 2.57e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116287
AA Change: C222F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111991
Gene: ENSMUSG00000030701
AA Change: C222F

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
low complexity region 197 218 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135255
Predicted Effect probably benign
Transcript: ENSMUST00000138830
SMART Domains Protein: ENSMUSP00000116888
Gene: ENSMUSG00000030701

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139708
SMART Domains Protein: ENSMUSP00000122333
Gene: ENSMUSG00000030701

DomainStartEndE-ValueType
PH 3 111 1.25e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151123
SMART Domains Protein: ENSMUSP00000115559
Gene: ENSMUSG00000030701

DomainStartEndE-ValueType
PH 22 130 1.25e-5 SMART
low complexity region 216 237 N/A INTRINSIC
Meta Mutation Damage Score 0.6408 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.4%
  • 20x: 91.4%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable with no abnormalities detected in growth, behavior including balance, inner ear histology, or serum and urine electrolyte concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G T 3: 138,067,947 G966W probably damaging Het
3110002H16Rik A G 18: 12,188,956 probably benign Het
A930009A15Rik G T 10: 115,578,362 probably null Het
Cant1 G T 11: 118,411,442 H16Q probably benign Het
Capn3 G T 2: 120,502,420 V612F probably damaging Het
Cep112 A T 11: 108,664,603 E141D probably damaging Het
Cept1 A G 3: 106,531,248 V173A probably benign Het
CN725425 A G 15: 91,235,826 D50G possibly damaging Het
Cubn A T 2: 13,491,695 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dpp8 A G 9: 65,078,109 probably null Het
Ecm1 G A 3: 95,735,857 T377I probably benign Het
Exosc8 A G 3: 54,731,179 probably benign Het
Fam129b G A 2: 32,920,982 V335M probably damaging Het
Fam71f1 G A 6: 29,319,298 E34K probably damaging Het
Fasn C T 11: 120,809,510 D2165N probably benign Het
Gab2 A G 7: 97,303,113 E571G probably damaging Het
Galnt5 C A 2: 57,999,625 H412Q probably benign Het
Galr1 T A 18: 82,405,864 Y96F possibly damaging Het
Gm8882 T C 6: 132,361,856 N133S unknown Het
Gnl2 C A 4: 125,055,365 probably benign Het
H2afx T C 9: 44,335,105 V115A probably benign Het
Heatr9 T C 11: 83,514,766 N317S possibly damaging Het
Hist1h2an A C 13: 21,786,911 I103S probably damaging Het
Kndc1 A G 7: 139,927,891 Y1254C probably damaging Het
Lrp6 A T 6: 134,459,296 D1302E probably benign Het
Mc2r A T 18: 68,407,948 Y91* probably null Het
Meis1 T G 11: 18,941,747 D267A possibly damaging Het
Mki67 T C 7: 135,699,981 K1108R possibly damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myh3 T G 11: 67,084,089 D219E probably damaging Het
Olfr1511 T C 14: 52,390,627 I49V probably damaging Het
Olfr857 T C 9: 19,713,274 L149P possibly damaging Het
Pi4ka A G 16: 17,293,953 C1553R probably damaging Het
Polr3d A T 14: 70,440,759 D165E possibly damaging Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Rab11fip5 A G 6: 85,374,137 L131P probably damaging Het
Raph1 A T 1: 60,493,498 probably benign Het
Scgb2b27 T G 7: 34,012,059 probably benign Het
Serpina10 T C 12: 103,626,661 D264G probably damaging Het
Sftpb A G 6: 72,304,667 T15A possibly damaging Het
Slc20a1 T C 2: 129,210,819 F674L probably benign Het
Syne2 A T 12: 75,938,721 N1648Y probably benign Het
Thsd7a G T 6: 12,332,017 N1265K possibly damaging Het
Trem2 T C 17: 48,351,774 L189P probably benign Het
Washc4 A T 10: 83,581,337 R865S probably damaging Het
Zfp536 A G 7: 37,568,792 S400P probably damaging Het
Other mutations in Plekhb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Plekhb1 APN 7 100655299 missense probably damaging 1.00
F5770:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
R0722:Plekhb1 UTSW 7 100645603 missense probably damaging 1.00
R1891:Plekhb1 UTSW 7 100655392 missense probably damaging 1.00
R3427:Plekhb1 UTSW 7 100645650 missense probably damaging 1.00
R5695:Plekhb1 UTSW 7 100655395 missense probably damaging 1.00
R5696:Plekhb1 UTSW 7 100656753 missense probably damaging 1.00
R5789:Plekhb1 UTSW 7 100645586 nonsense probably null
R6633:Plekhb1 UTSW 7 100645639 missense probably damaging 1.00
R7304:Plekhb1 UTSW 7 100645667 missense probably benign 0.19
V7580:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
V7582:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
V7583:Plekhb1 UTSW 7 100654618 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGCTTCCTTTGAGACGGAAAAG -3'
(R):5'- CTCTGGGGAGCAGAATGAGTTC -3'

Sequencing Primer
(F):5'- CTTTGAGACGGAAAAGAGGATAAATG -3'
(R):5'- CTTGAGATTAGACTAGTCTCTGGCAC -3'
Posted On2016-10-05