Incidental Mutation 'R6607:Rbks'
ID525731
Institutional Source Beutler Lab
Gene Symbol Rbks
Ensembl Gene ENSMUSG00000029136
Gene Nameribokinase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R6607 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location31624439-31697627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31647792 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 243 (V243M)
Ref Sequence ENSEMBL: ENSMUSP00000031018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031018] [ENSMUST00000201910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031018
AA Change: V243M

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031018
Gene: ENSMUSG00000029136
AA Change: V243M

DomainStartEndE-ValueType
Pfam:PfkB 16 315 2.1e-66 PFAM
Pfam:Phos_pyr_kin 166 306 9.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200694
Predicted Effect probably benign
Transcript: ENSMUST00000201910
SMART Domains Protein: ENSMUSP00000144669
Gene: ENSMUSG00000106918

DomainStartEndE-ValueType
PDB:4CE4|6 1 49 9e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202243
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carbohydrate kinase PfkB family. The encoded protein phosphorylates ribose to form ribose-5-phosphate in the presence of ATP and magnesium as a first step in ribose metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,306 D92G possibly damaging Het
Ace A T 11: 105,972,377 H326L possibly damaging Het
Adtrp A G 13: 41,777,611 F167L probably benign Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Cdh4 G A 2: 179,874,096 V356I probably benign Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Ctbs A G 3: 146,457,373 D172G possibly damaging Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Dut A G 2: 125,256,867 D140G probably damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Esyt2 G A 12: 116,368,740 D781N probably benign Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Foxq1 A G 13: 31,559,146 D77G possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Hamp2 T A 7: 30,922,588 R59* probably null Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Tmem26 T A 10: 68,778,713 H319Q probably benign Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn1r223 T C 13: 23,249,749 I171T probably damaging Het
Vmn2r101 T C 17: 19,612,034 L764S probably damaging Het
Vmn2r84 T C 10: 130,390,862 H369R possibly damaging Het
Other mutations in Rbks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Rbks APN 5 31660017 missense probably damaging 1.00
IGL02618:Rbks APN 5 31624519 nonsense probably null
IGL02678:Rbks APN 5 31673413 missense probably damaging 1.00
IGL02719:Rbks APN 5 31651801 intron probably benign
IGL02947:Rbks APN 5 31660063 missense probably benign
R0334:Rbks UTSW 5 31624519 nonsense probably null
R1441:Rbks UTSW 5 31659997 missense probably benign
R2568:Rbks UTSW 5 31665752 missense probably damaging 0.99
R4545:Rbks UTSW 5 31624568 missense probably benign 0.10
R4546:Rbks UTSW 5 31624568 missense probably benign 0.10
R4591:Rbks UTSW 5 31660008 missense possibly damaging 0.52
R4833:Rbks UTSW 5 31624515 missense probably benign 0.00
R4967:Rbks UTSW 5 31624532 missense probably damaging 1.00
R5076:Rbks UTSW 5 31650451 nonsense probably null
R5214:Rbks UTSW 5 31650392 intron probably benign
R6051:Rbks UTSW 5 31651819 missense probably damaging 1.00
R6194:Rbks UTSW 5 31666890 missense probably benign 0.05
R7246:Rbks UTSW 5 31647783 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CCAATGACTTAGCAGAGGTCAG -3'
(R):5'- TGTTTCCTAAAGGGCAGACC -3'

Sequencing Primer
(F):5'- AGGGCTCTCCTGTTTGGCTATC -3'
(R):5'- AGACCTGAGCAGACCTCG -3'
Posted On2018-06-22