Incidental Mutation 'R6717:Efcab7'
ID529421
Institutional Source Beutler Lab
Gene Symbol Efcab7
Ensembl Gene ENSMUSG00000073791
Gene NameEF-hand calcium binding domain 7
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_145549; MGI: 2385199

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location99829198-99912788 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99904734 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 407 (D407G)
Ref Sequence ENSEMBL: ENSMUSP00000095572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097959] [ENSMUST00000136874]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097959
AA Change: D407G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095572
Gene: ENSMUSG00000073791
AA Change: D407G

DomainStartEndE-ValueType
low complexity region 85 99 N/A INTRINSIC
SCOP:d2pvba_ 339 408 2e-4 SMART
Blast:EFh 348 376 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123830
Predicted Effect probably benign
Transcript: ENSMUST00000136874
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Cog2 T C 8: 124,525,749 I64T probably damaging Het
Dhx9 A C 1: 153,473,464 probably null Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Efcab7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Efcab7 APN 4 99831463 missense probably benign 0.12
3-1:Efcab7 UTSW 4 99901769 missense possibly damaging 0.83
R0023:Efcab7 UTSW 4 99901637 splice site probably benign
R0085:Efcab7 UTSW 4 99904680 unclassified probably benign
R0122:Efcab7 UTSW 4 99892363 splice site probably benign
R0326:Efcab7 UTSW 4 99831394 missense possibly damaging 0.86
R0382:Efcab7 UTSW 4 99901769 missense possibly damaging 0.83
R0410:Efcab7 UTSW 4 99878285 critical splice donor site probably null
R0413:Efcab7 UTSW 4 99909746 missense probably damaging 1.00
R0611:Efcab7 UTSW 4 99901689 missense probably damaging 1.00
R0689:Efcab7 UTSW 4 99904784 missense probably damaging 1.00
R1114:Efcab7 UTSW 4 99878250 nonsense probably null
R1459:Efcab7 UTSW 4 99912547 missense probably null 1.00
R1722:Efcab7 UTSW 4 99900618 missense probably benign 0.36
R1932:Efcab7 UTSW 4 99911018 missense probably damaging 1.00
R1954:Efcab7 UTSW 4 99900690 missense probably damaging 1.00
R2305:Efcab7 UTSW 4 99831481 missense possibly damaging 0.95
R2358:Efcab7 UTSW 4 99831586 unclassified probably benign
R2845:Efcab7 UTSW 4 99909638 missense probably damaging 0.99
R3915:Efcab7 UTSW 4 99878173 missense probably damaging 0.98
R4469:Efcab7 UTSW 4 99909704 missense possibly damaging 0.73
R4686:Efcab7 UTSW 4 99878116 missense probably benign 0.29
R4737:Efcab7 UTSW 4 99831568 nonsense probably null
R4970:Efcab7 UTSW 4 99831543 missense probably damaging 1.00
R5120:Efcab7 UTSW 4 99897491 missense probably damaging 1.00
R5264:Efcab7 UTSW 4 99878170 missense probably benign 0.27
R5366:Efcab7 UTSW 4 99904734 missense possibly damaging 0.95
R5901:Efcab7 UTSW 4 99909744 missense probably damaging 0.99
R6255:Efcab7 UTSW 4 99829390 unclassified probably benign
R6438:Efcab7 UTSW 4 99909772 missense probably benign 0.39
R6451:Efcab7 UTSW 4 99831501 nonsense probably null
R6766:Efcab7 UTSW 4 99877959 frame shift probably null
R6855:Efcab7 UTSW 4 99900580 nonsense probably null
R6865:Efcab7 UTSW 4 99912596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGTCCTATGATGGTGTCTG -3'
(R):5'- TCCAGGGACTTGAGTGTCTAG -3'

Sequencing Primer
(F):5'- TGTTGAGCTGTGGGAAGTTAGAAAG -3'
(R):5'- TGAGTGTCTAGATTTAAAAAGTCCTG -3'
Posted On2018-08-01