Incidental Mutation 'R6717:Cog2'
ID529441
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Namecomponent of oligomeric golgi complex 2
Synonyms2700012E02Rik, 1190002B08Rik, Cog2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6717 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124520767-124552008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124525749 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 64 (I64T)
Ref Sequence ENSEMBL: ENSMUSP00000135022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460] [ENSMUST00000176159] [ENSMUST00000176279]
Predicted Effect probably damaging
Transcript: ENSMUST00000034460
AA Change: I64T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: I64T

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108803
Predicted Effect silent
Transcript: ENSMUST00000176159
SMART Domains Protein: ENSMUSP00000135600
Gene: ENSMUSG00000031979

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000176279
AA Change: I64T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135022
Gene: ENSMUSG00000031979
AA Change: I64T

DomainStartEndE-ValueType
Pfam:COG2 15 101 1.5e-37 PFAM
Meta Mutation Damage Score 0.498 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 4,064,086 L3122F probably damaging Het
Atp6v1b1 A T 6: 83,753,650 probably null Het
Ccdc178 A T 18: 22,020,889 V621E probably damaging Het
Cfap126 T C 1: 171,114,102 probably null Het
Dhx9 A C 1: 153,473,464 probably null Het
Efcab7 A G 4: 99,904,734 D407G possibly damaging Het
Eif2b5 G T 16: 20,505,283 G459C probably damaging Het
Eml5 T C 12: 98,827,506 E1168G probably damaging Het
Flnc AGCTGTCAAGTATGCTG AGCTG 6: 29,450,902 probably benign Het
Fry A G 5: 150,496,312 T980A probably benign Het
Gabbr2 A G 4: 46,787,574 V363A possibly damaging Het
Ggt6 T A 11: 72,437,520 L244* probably null Het
Gm13119 G T 4: 144,362,657 V182L probably benign Het
Gprc6a T A 10: 51,615,137 I768F probably damaging Het
Grk1 G A 8: 13,416,237 M560I probably benign Het
Hapln4 G A 8: 70,085,090 E145K probably damaging Het
Hoxd9 C T 2: 74,698,389 P112S probably benign Het
Ly6g6f T A 17: 35,085,574 M1L probably benign Het
Mast1 T C 8: 84,917,754 T849A probably benign Het
Mob4 A T 1: 55,136,713 M39L possibly damaging Het
Mrgpre A T 7: 143,781,523 L81Q probably damaging Het
Mst1 T C 9: 108,080,575 probably null Het
Muc5b A T 7: 141,857,822 R1502* probably null Het
Olfr1020 T A 2: 85,850,223 I257N probably damaging Het
Olfr142 T A 2: 90,252,524 I155L probably benign Het
Olfr311 T C 11: 58,841,287 Y58H probably damaging Het
Pdc A G 1: 150,333,018 D84G probably damaging Het
Peak1 T C 9: 56,207,239 N443D probably benign Het
Pkd1l3 T A 8: 109,614,769 W85R unknown Het
Rfc1 G A 5: 65,302,004 Q190* probably null Het
Rfc1 A G 5: 65,312,961 S68P probably damaging Het
Rnf145 T C 11: 44,561,490 V432A probably benign Het
Ror2 A G 13: 53,118,982 S204P probably damaging Het
Scn1a T C 2: 66,332,287 E205G probably damaging Het
Slc2a8 A C 2: 32,976,177 M277R probably damaging Het
Slc4a1 T C 11: 102,354,423 Y566C probably damaging Het
Slc6a12 A G 6: 121,354,303 N185S probably benign Het
Srcap GCTCCTCCTCCTCCTCCT GCTCCTCCTCCTCCT 7: 127,558,310 probably benign Het
Stk33 T A 7: 109,327,616 T279S possibly damaging Het
Taok3 A G 5: 117,240,950 probably benign Het
Tlr11 A G 14: 50,362,104 T516A probably benign Het
Tmem132c T A 5: 127,564,029 L1088Q possibly damaging Het
Tmem132d T A 5: 127,784,421 M879L probably benign Het
Tnk2 A G 16: 32,670,869 E322G probably damaging Het
Ttc28 T C 5: 111,285,436 V2081A probably benign Het
Ttn C T 2: 76,794,409 probably null Het
Zfp105 T C 9: 122,930,308 V348A possibly damaging Het
Zswim2 T C 2: 83,915,409 R562G probably benign Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 124545243 missense probably benign 0.00
IGL01092:Cog2 APN 8 124545280 missense probably damaging 1.00
IGL01150:Cog2 APN 8 124542891 missense possibly damaging 0.62
IGL02052:Cog2 APN 8 124542888 critical splice acceptor site probably null
IGL02308:Cog2 APN 8 124533212 critical splice acceptor site probably null
IGL02543:Cog2 APN 8 124529959 missense probably benign 0.09
IGL02978:Cog2 APN 8 124550336 missense probably benign
IGL03008:Cog2 APN 8 124535392 splice site probably benign
IGL03144:Cog2 APN 8 124541024 missense probably damaging 0.98
kugge UTSW 8 124550232 missense probably damaging 1.00
pelota UTSW 8 124550306 missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 124545271 missense probably benign 0.22
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0110:Cog2 UTSW 8 124529058 critical splice donor site probably null
R0436:Cog2 UTSW 8 124548514 splice site probably benign
R0450:Cog2 UTSW 8 124529058 critical splice donor site probably null
R1365:Cog2 UTSW 8 124540974 missense probably damaging 0.97
R1661:Cog2 UTSW 8 124542890 missense probably benign 0.20
R1698:Cog2 UTSW 8 124525683 missense probably damaging 1.00
R1856:Cog2 UTSW 8 124551403 missense possibly damaging 0.93
R2122:Cog2 UTSW 8 124528985 missense possibly damaging 0.91
R2398:Cog2 UTSW 8 124529926 missense probably benign 0.07
R3855:Cog2 UTSW 8 124530003 critical splice donor site probably null
R4580:Cog2 UTSW 8 124545136 missense probably benign 0.01
R4803:Cog2 UTSW 8 124535451 missense probably damaging 0.96
R5316:Cog2 UTSW 8 124529040 missense probably benign 0.14
R5346:Cog2 UTSW 8 124546631 missense possibly damaging 0.94
R5394:Cog2 UTSW 8 124532529 missense probably benign 0.00
R5395:Cog2 UTSW 8 124545221 missense probably benign 0.00
R5738:Cog2 UTSW 8 124546038 missense probably benign 0.03
R5861:Cog2 UTSW 8 124537878 missense probably damaging 1.00
R5894:Cog2 UTSW 8 124545267 missense probably benign 0.00
R5941:Cog2 UTSW 8 124546086 missense probably benign
R6186:Cog2 UTSW 8 124546686 missense probably damaging 1.00
R6400:Cog2 UTSW 8 124550306 missense probably damaging 1.00
R6518:Cog2 UTSW 8 124527103 nonsense probably null
R6558:Cog2 UTSW 8 124550232 missense probably damaging 1.00
R6902:Cog2 UTSW 8 124546691 missense probably damaging 1.00
R6914:Cog2 UTSW 8 124545136 missense probably benign 0.00
R6942:Cog2 UTSW 8 124545136 missense probably benign 0.00
R7103:Cog2 UTSW 8 124541114 critical splice donor site probably null
R7274:Cog2 UTSW 8 124535519 missense possibly damaging 0.71
X0026:Cog2 UTSW 8 124546020 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCCCTGTAGAATGCGATCAC -3'
(R):5'- TTTACTGGGCGCTTGAACC -3'

Sequencing Primer
(F):5'- TCACAAGGAGGCACGCTTG -3'
(R):5'- CGCTTGAACCCTGAAACTGTATGG -3'
Posted On2018-08-01