Incidental Mutation 'R6890:Npr3'
ID537170
Institutional Source Beutler Lab
Gene Symbol Npr3
Ensembl Gene ENSMUSG00000022206
Gene Namenatriuretic peptide receptor 3
Synonymslongjohn, NPR-C, B430320C24Rik, Nppc receptor, lgj
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R6890 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location11839896-11907287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11883392 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 317 (V317A)
Ref Sequence ENSEMBL: ENSMUSP00000066737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066529] [ENSMUST00000228489] [ENSMUST00000228603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066529
AA Change: V317A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066737
Gene: ENSMUSG00000022206
AA Change: V317A

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:ANF_receptor 66 417 1e-59 PFAM
transmembrane domain 477 499 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000228489
AA Change: V63A

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228603
AA Change: V317A

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three natriuretic peptide receptors. Natriutetic peptides are small peptides which regulate blood volume and pressure, pulmonary hypertension, and cardiac function as well as some metabolic and growth processes. The product of this gene encodes a natriuretic peptide receptor responsible for clearing circulating and extracellular natriuretic peptides through endocytosis of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous inactivation of this gene leads to partial postnatal lethality, altered blood homeostasis, polyuria, hypovolemia, hypotension, increased bone turnover, skeletal deformities and altered adipose morphology. Spontaneous and ENU-induced mutations cause a skeletal-overgrowth phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Npr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Npr3 APN 15 11895694 missense probably damaging 1.00
IGL01420:Npr3 APN 15 11858632 missense probably damaging 1.00
IGL01599:Npr3 APN 15 11895789 missense probably damaging 1.00
IGL01977:Npr3 APN 15 11858718 missense probably damaging 1.00
eel UTSW 15 11858647 missense probably damaging 0.99
R0581:Npr3 UTSW 15 11851450 missense probably damaging 0.99
R0607:Npr3 UTSW 15 11845282 missense probably benign 0.32
R1554:Npr3 UTSW 15 11848563 missense probably benign
R1779:Npr3 UTSW 15 11851486 missense probably damaging 1.00
R1793:Npr3 UTSW 15 11848579 missense probably benign 0.05
R1968:Npr3 UTSW 15 11904969 missense probably benign 0.31
R2379:Npr3 UTSW 15 11883363 missense probably damaging 0.99
R2883:Npr3 UTSW 15 11883324 missense possibly damaging 0.50
R3080:Npr3 UTSW 15 11905149 missense probably benign 0.01
R3745:Npr3 UTSW 15 11905491 missense probably damaging 1.00
R3803:Npr3 UTSW 15 11895790 missense probably damaging 1.00
R4166:Npr3 UTSW 15 11848513 missense probably benign 0.32
R4411:Npr3 UTSW 15 11905149 missense probably benign 0.01
R4412:Npr3 UTSW 15 11905149 missense probably benign 0.01
R4667:Npr3 UTSW 15 11905467 missense possibly damaging 0.58
R5209:Npr3 UTSW 15 11848603 missense possibly damaging 0.73
R5742:Npr3 UTSW 15 11883408 missense probably damaging 1.00
R6339:Npr3 UTSW 15 11845275 missense probably damaging 0.99
R6605:Npr3 UTSW 15 11905432 missense probably damaging 1.00
S24628:Npr3 UTSW 15 11848563 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCGACACTCAGACTTGAAC -3'
(R):5'- CTCTGCTGCCAAAGGTACCATG -3'

Sequencing Primer
(F):5'- TTTTGAATGGCTCAGAATGGGACAC -3'
(R):5'- TACCATGTAGGGACACATTGC -3'
Posted On2018-10-18