Incidental Mutation 'R7014:Cyfip1'
ID545188
Institutional Source Beutler Lab
Gene Symbol Cyfip1
Ensembl Gene ENSMUSG00000030447
Gene Namecytoplasmic FMR1 interacting protein 1
Synonymsl(7)1Rl, pl-1, P140SRA-1, l7Rl1, Sra-1, Shyc, E030028J09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7014 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location55841745-55932602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55919493 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 917 (I917T)
Ref Sequence ENSEMBL: ENSMUSP00000127717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032629] [ENSMUST00000085255] [ENSMUST00000163845] [ENSMUST00000206862]
Predicted Effect probably benign
Transcript: ENSMUST00000032629
AA Change: I917T

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032629
Gene: ENSMUSG00000030447
AA Change: I917T

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 302 5.7e-11 PFAM
Pfam:FragX_IP 389 1222 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085255
AA Change: I915T

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000082353
Gene: ENSMUSG00000030447
AA Change: I915T

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1222 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163845
AA Change: I917T

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127717
Gene: ENSMUSG00000030447
AA Change: I917T

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1224 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206862
AA Change: I887T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (80/81)
MGI Phenotype PHENOTYPE: Mutations at this locus result in embryonic lethality before the turning stage in homozygotes. Heterozygotes exhibit abnormal synaptic transmission. Parental origin of the mutant allele in heterozygotes has an effect on long term depression, cued fear conditioning, anxiety, and activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,578,773 Q156* probably null Het
2700097O09Rik A G 12: 55,045,942 I264T probably benign Het
Arid3a G T 10: 79,950,884 M488I possibly damaging Het
Auts2 A G 5: 131,466,123 F331S probably damaging Het
Axdnd1 T C 1: 156,330,962 probably null Het
Bpifb5 C A 2: 154,224,956 S43* probably null Het
Carhsp1 A G 16: 8,661,005 V128A probably benign Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cdk6 C G 5: 3,473,152 L191V probably damaging Het
Cgnl1 T G 9: 71,725,134 K312Q possibly damaging Het
Col6a1 T C 10: 76,721,443 E225G probably damaging Het
Copg1 T A 6: 87,902,340 L456Q probably damaging Het
Ctif T A 18: 75,437,208 D540V possibly damaging Het
Cyth1 T C 11: 118,212,651 D9G probably benign Het
Dnajb1 T C 8: 83,610,255 I118T probably damaging Het
Ebna1bp2 T A 4: 118,623,378 Y139* probably null Het
Fam162a A T 16: 36,049,932 V59E probably damaging Het
Fam213a T C 14: 41,002,494 E71G probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmo6 C G 1: 162,926,308 R112T probably benign Het
Gm11639 A G 11: 104,693,422 T100A probably benign Het
Gm17087 T A 17: 8,566,472 D133V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gm21994 A T 2: 150,255,262 C82* probably null Het
Gm42669 A G 5: 107,508,276 I802V probably benign Het
Gp2 T C 7: 119,451,645 N288D probably damaging Het
Gstm7 C T 3: 107,926,962 D196N probably benign Het
Hsph1 A T 5: 149,630,400 V201D probably damaging Het
Il20ra T C 10: 19,712,710 L26P unknown Het
Itpr1 T A 6: 108,431,498 probably null Het
Kcns3 A T 12: 11,091,687 I337N probably damaging Het
Kdm4d A G 9: 14,464,179 Y128H probably damaging Het
Kirrel2 A G 7: 30,454,574 I200T probably benign Het
Klhdc10 T A 6: 30,450,503 I294N probably damaging Het
Map1a A C 2: 121,300,239 N512T probably damaging Het
March8 C G 6: 116,403,543 C118W probably damaging Het
March8 T G 6: 116,403,544 C119G probably damaging Het
Mrpl38 G T 11: 116,134,915 P195Q probably damaging Het
Ms4a4d A T 19: 11,548,583 Q27L probably benign Het
Muc16 T A 9: 18,658,236 T996S unknown Het
Mug1 C T 6: 121,861,125 A438V probably benign Het
Mup7 T A 4: 60,069,866 I33F probably damaging Het
Ndufa5 C T 6: 24,519,191 probably null Het
Olfr1133 A T 2: 87,645,976 L49Q probably damaging Het
Olfr1141 T C 2: 87,753,871 I41V probably benign Het
Olfr1535 A G 13: 21,555,938 F28S probably benign Het
Olfr167 A T 16: 19,515,456 F60Y probably benign Het
Olfr873 T A 9: 20,300,663 C154* probably null Het
Parp9 T A 16: 35,960,063 probably null Het
Pbx1 T A 1: 168,431,380 D42V probably damaging Het
Pde4dip G T 3: 97,715,422 N1490K possibly damaging Het
Pdzd2 T C 15: 12,372,561 N2496S probably benign Het
Pdzd2 A G 15: 12,372,975 M2358T probably benign Het
Pglyrp2 C A 17: 32,415,930 C486F probably damaging Het
Pi4ka A G 16: 17,297,067 probably benign Het
Pknox2 T A 9: 36,909,667 T300S probably damaging Het
Plekhm3 A G 1: 64,883,270 I582T probably damaging Het
Prtg T C 9: 72,891,985 Y766H possibly damaging Het
Rabgap1 A G 2: 37,560,563 E901G probably benign Het
Rabgap1l A T 1: 160,342,072 N60K probably damaging Het
Rnf150 C T 8: 83,042,663 T359I probably benign Het
Rps6ka2 C T 17: 7,255,932 H236Y probably benign Het
Rrp1b T A 17: 32,049,427 L120Q probably damaging Het
Scn7a C A 2: 66,741,959 G223C probably null Het
Sema6a T A 18: 47,298,217 N138I probably damaging Het
Sept5 T A 16: 18,624,909 I97F probably damaging Het
Shcbp1 T A 8: 4,754,234 E225D probably damaging Het
Slc25a19 A G 11: 115,620,966 C124R probably damaging Het
Slc37a2 C T 9: 37,233,887 A428T probably damaging Het
Slc5a12 A G 2: 110,644,364 I538V probably benign Het
Slco4c1 A T 1: 96,823,781 probably null Het
Smarcad1 T C 6: 65,052,670 S81P probably damaging Het
Smyd1 T C 6: 71,238,627 D116G probably damaging Het
Themis T C 10: 28,789,707 Y589H probably benign Het
Trim30d T C 7: 104,483,336 K248R probably benign Het
Tspan12 C T 6: 21,772,919 M210I probably benign Het
Vmn2r11 T C 5: 109,053,423 Y405C probably damaging Het
Wdfy3 A G 5: 101,894,909 probably null Het
Wiz C A 17: 32,361,866 A83S probably damaging Het
Zmym6 T A 4: 127,123,544 Y947* probably null Het
Other mutations in Cyfip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Cyfip1 APN 7 55904210 missense probably damaging 1.00
IGL01351:Cyfip1 APN 7 55898243 nonsense probably null
IGL01662:Cyfip1 APN 7 55896739 missense probably damaging 1.00
IGL02034:Cyfip1 APN 7 55898353 missense probably damaging 0.99
IGL02039:Cyfip1 APN 7 55875021 missense possibly damaging 0.90
IGL02063:Cyfip1 APN 7 55926348 missense probably damaging 1.00
IGL02429:Cyfip1 APN 7 55871982 splice site probably benign
IGL03256:Cyfip1 APN 7 55907434 missense possibly damaging 0.67
R0455:Cyfip1 UTSW 7 55892054 missense probably benign 0.18
R0546:Cyfip1 UTSW 7 55922816 nonsense probably null
R0671:Cyfip1 UTSW 7 55923962 unclassified probably null
R0732:Cyfip1 UTSW 7 55886781 missense probably damaging 1.00
R0843:Cyfip1 UTSW 7 55922820 missense probably benign 0.24
R1666:Cyfip1 UTSW 7 55871898 missense probably damaging 0.99
R1789:Cyfip1 UTSW 7 55926395 missense probably damaging 1.00
R1817:Cyfip1 UTSW 7 55873448 missense possibly damaging 0.51
R1929:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2271:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2272:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2328:Cyfip1 UTSW 7 55894991 missense possibly damaging 0.87
R2518:Cyfip1 UTSW 7 55928284 missense probably damaging 1.00
R2963:Cyfip1 UTSW 7 55895035 missense probably damaging 0.99
R4271:Cyfip1 UTSW 7 55879101 missense probably benign 0.02
R4435:Cyfip1 UTSW 7 55900041 missense probably damaging 0.99
R4640:Cyfip1 UTSW 7 55913451 missense possibly damaging 0.92
R4676:Cyfip1 UTSW 7 55875013 missense probably damaging 0.99
R4887:Cyfip1 UTSW 7 55872068 missense probably damaging 1.00
R5085:Cyfip1 UTSW 7 55898335 missense probably benign 0.33
R5238:Cyfip1 UTSW 7 55892031 missense probably benign
R5244:Cyfip1 UTSW 7 55925199 missense probably damaging 1.00
R5288:Cyfip1 UTSW 7 55925135 missense possibly damaging 0.60
R5294:Cyfip1 UTSW 7 55873483 missense possibly damaging 0.88
R5552:Cyfip1 UTSW 7 55872107 missense possibly damaging 0.94
R5558:Cyfip1 UTSW 7 55892001 missense possibly damaging 0.71
R5667:Cyfip1 UTSW 7 55873730 missense probably benign 0.19
R5819:Cyfip1 UTSW 7 55879151 missense probably damaging 1.00
R5859:Cyfip1 UTSW 7 55925181 missense probably damaging 1.00
R5867:Cyfip1 UTSW 7 55926313 missense probably damaging 1.00
R5868:Cyfip1 UTSW 7 55926313 missense probably damaging 1.00
R5944:Cyfip1 UTSW 7 55872130 missense probably damaging 0.98
R6124:Cyfip1 UTSW 7 55897943 missense probably benign 0.12
R6131:Cyfip1 UTSW 7 55873480 missense possibly damaging 0.79
R6219:Cyfip1 UTSW 7 55908441 missense possibly damaging 0.52
R6243:Cyfip1 UTSW 7 55900529 missense probably damaging 1.00
R6669:Cyfip1 UTSW 7 55900061 missense probably damaging 0.99
R6869:Cyfip1 UTSW 7 55907365 missense possibly damaging 0.73
R7224:Cyfip1 UTSW 7 55928189 frame shift probably null
R7225:Cyfip1 UTSW 7 55928189 frame shift probably null
R7305:Cyfip1 UTSW 7 55928189 frame shift probably null
R7336:Cyfip1 UTSW 7 55926400 missense possibly damaging 0.96
R7429:Cyfip1 UTSW 7 55900593 missense probably damaging 1.00
R7430:Cyfip1 UTSW 7 55900593 missense probably damaging 1.00
R7469:Cyfip1 UTSW 7 55877720 missense possibly damaging 0.91
R7568:Cyfip1 UTSW 7 55872249 intron probably null
X0018:Cyfip1 UTSW 7 55900025 missense probably damaging 0.98
X0028:Cyfip1 UTSW 7 55907430 missense probably damaging 1.00
Z1088:Cyfip1 UTSW 7 55875052 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGGCTCCTTCGCTTAAGATG -3'
(R):5'- AGAAATGTCTGAAGCTAGTTGAAGC -3'

Sequencing Primer
(F):5'- TGTGGTACAAATTGAACACATCTCCC -3'
(R):5'- GTTTCTGCTACACATCCCAGACAG -3'
Posted On2019-05-13