Incidental Mutation 'PIT4651001:Cacna1d'
ID556695
Institutional Source Beutler Lab
Gene Symbol Cacna1d
Ensembl Gene ENSMUSG00000015968
Gene Namecalcium channel, voltage-dependent, L type, alpha 1D subunit
SynonymsC79217, Cchl1a2, Cav1.3alpha1, Cchl1a, Cacnl1a2, D-LTCC, 8430418G19Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #PIT4651001 (G1)
Quality Score196.009
Status Not validated
Chromosome14
Chromosomal Location30039939-30491455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30178645 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 361 (G361D)
Ref Sequence ENSEMBL: ENSMUSP00000107869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112249] [ENSMUST00000112250] [ENSMUST00000223803] [ENSMUST00000224198] [ENSMUST00000224395] [ENSMUST00000224785]
Predicted Effect probably damaging
Transcript: ENSMUST00000112249
AA Change: G339D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107868
Gene: ENSMUSG00000015968
AA Change: G339D

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
Pfam:Ion_trans 163 405 4.8e-59 PFAM
PDB:4DEY|B 406 502 3e-38 PDB
low complexity region 503 517 N/A INTRINSIC
Pfam:Ion_trans 557 751 5.5e-46 PFAM
low complexity region 766 781 N/A INTRINSIC
low complexity region 819 840 N/A INTRINSIC
Pfam:Ion_trans 921 1151 7.2e-51 PFAM
Pfam:Ion_trans 1239 1448 3.6e-67 PFAM
Pfam:PKD_channel 1285 1455 1.9e-9 PFAM
Blast:EFh 1469 1497 2e-9 BLAST
Ca_chan_IQ 1583 1617 5.05e-16 SMART
low complexity region 1649 1661 N/A INTRINSIC
low complexity region 1722 1728 N/A INTRINSIC
low complexity region 1830 1840 N/A INTRINSIC
low complexity region 1885 1905 N/A INTRINSIC
low complexity region 1921 1936 N/A INTRINSIC
low complexity region 2122 2133 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112250
AA Change: G361D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107869
Gene: ENSMUSG00000015968
AA Change: G361D

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
Pfam:Ion_trans 147 439 5.6e-72 PFAM
low complexity region 473 482 N/A INTRINSIC
low complexity region 525 539 N/A INTRINSIC
Pfam:Ion_trans 544 784 2e-56 PFAM
low complexity region 788 803 N/A INTRINSIC
low complexity region 841 862 N/A INTRINSIC
Pfam:Ion_trans 907 1185 2.6e-63 PFAM
Pfam:Ion_trans 1226 1482 1.7e-70 PFAM
Pfam:PKD_channel 1306 1477 1.2e-9 PFAM
Pfam:GPHH 1484 1553 2.3e-38 PFAM
Ca_chan_IQ 1605 1639 5.05e-16 SMART
Pfam:CAC1F_C 1649 2165 1.1e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223803
AA Change: G339D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000224198
AA Change: G339D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224395
AA Change: G339D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224785
AA Change: G339D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 70.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a pore-forming subunit of the L-type, voltage-activated calcium channel family. These channels have been found to play a role in heart and smooth muscle contraction and in the transmission of auditory information. Homozygous knockout mice for this gene exhibit deafness and heart defects. These channels have also been linked to mitochondrial oxidative stress in a mouse model of Parkinson's disease. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for targeted mutations exhibit small size, hypoinsulinemia, glucose intolerance, decreased number and size of pancreatic islets, deafness with degeneration of hair cells, bradycardia, and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,259,895 I428L probably benign Het
Aass T C 6: 23,118,751 I131V probably benign Het
Alcam T A 16: 52,295,187 K189N probably benign Het
Ankrd50 C A 3: 38,455,810 E803* probably null Het
Ankrd53 A G 6: 83,765,733 D236G probably damaging Het
Bard1 A G 1: 71,074,928 V298A probably benign Het
Camkk1 A G 11: 73,025,821 S82G probably benign Het
Ccr4 A T 9: 114,492,193 V268E probably benign Het
Cdh6 G A 15: 13,044,719 S439L possibly damaging Het
Ces1e G T 8: 93,215,083 A254E probably benign Het
Cfap46 T C 7: 139,645,551 T1078A Het
Cyp46a1 A G 12: 108,353,108 D288G probably benign Het
Dnah6 T C 6: 73,060,260 N3333S probably benign Het
Dzip3 A G 16: 48,944,878 V491A probably benign Het
Egr1 G T 18: 34,863,187 E341* probably null Het
Enpp1 G A 10: 24,653,950 P597S probably benign Het
Ercc3 A T 18: 32,240,312 probably benign Het
Fam160a1 C T 3: 85,683,641 A389T probably damaging Het
Fbn1 T C 2: 125,363,989 probably null Het
Fbxw11 T C 11: 32,711,999 probably null Het
Gbf1 A G 19: 46,163,543 N5S probably benign Het
Gbp4 T A 5: 105,118,423 H584L probably benign Het
Gcgr G T 11: 120,538,142 C402F probably damaging Het
Gm3550 A T 18: 34,737,839 Q142L unknown Het
Grm7 T A 6: 110,646,089 N74K probably benign Het
Hils1 A G 11: 94,968,316 S146G probably benign Het
Hoxa10 T G 6: 52,234,897 N13T possibly damaging Het
Ice1 A T 13: 70,623,921 probably null Het
Il22 C A 10: 118,205,590 N69K probably damaging Het
Il9r A T 11: 32,191,798 H319Q probably benign Het
Itgax A G 7: 128,149,110 T1104A probably benign Het
Jag1 C T 2: 137,101,697 G193D probably damaging Het
Krt13 T A 11: 100,120,036 D164V probably damaging Het
Lepr T C 4: 101,791,997 M865T probably damaging Het
Lmf2 G A 15: 89,352,069 H576Y possibly damaging Het
Lrrc8c C T 5: 105,608,323 H655Y probably benign Het
Mapk6 A T 9: 75,397,587 S183T possibly damaging Het
Mcrs1 A T 15: 99,246,951 Y261N probably damaging Het
Mon1b G A 8: 113,638,622 G194D probably benign Het
Myo18b C T 5: 112,834,435 R1144Q probably benign Het
Myo9b T A 8: 71,342,812 H808Q possibly damaging Het
Ngdn T C 14: 55,016,200 I15T probably benign Het
Nhsl1 T G 10: 18,408,435 S41R probably damaging Het
Numa1 A T 7: 102,013,934 K2089M probably damaging Het
Obscn A G 11: 59,041,681 L4900P probably damaging Het
Olfm4 T A 14: 80,021,485 L391Q probably benign Het
Olfr1034 T C 2: 86,046,518 L12P probably damaging Het
Olfr1459 T A 19: 13,146,627 I11F probably benign Het
Olfr1465 A G 19: 13,314,192 I31T probably benign Het
Olfr705 A G 7: 106,873,523 C241R probably damaging Het
Olfr980 A T 9: 40,006,230 C240S probably damaging Het
Park2 T A 17: 11,067,243 L41Q probably damaging Het
Parn T A 16: 13,631,567 N302Y probably benign Het
Pi4k2b T G 5: 52,748,470 S118A possibly damaging Het
Piwil4 C T 9: 14,708,899 V704I possibly damaging Het
Pm20d2 G A 4: 33,181,715 T296M probably damaging Het
Pmpcb C T 5: 21,746,050 A270V probably benign Het
Pnpt1 T C 11: 29,156,945 probably null Het
Rc3h1 C A 1: 160,963,540 N931K probably benign Het
Rlf A G 4: 121,150,313 V600A probably damaging Het
Rnf219 T A 14: 104,506,256 D129V probably damaging Het
Sall1 T G 8: 89,031,103 Q791P probably damaging Het
Sema3c T A 5: 17,694,733 Y408N probably benign Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Tmem181a A T 17: 6,300,895 M319L probably benign Het
Trim24 T C 6: 37,900,732 probably null Het
Ttn T A 2: 76,888,934 T7234S unknown Het
Unc13c T A 9: 73,483,739 M2076L possibly damaging Het
Uroc1 C T 6: 90,363,113 R667* probably null Het
Uvrag A G 7: 98,906,520 F456L probably benign Het
Vmn1r215 T C 13: 23,076,360 V190A probably damaging Het
Vmn2r50 T A 7: 10,037,732 T681S probably benign Het
Vmn2r65 T A 7: 84,946,253 T408S probably benign Het
Vps33b A G 7: 80,290,007 D502G probably damaging Het
Other mutations in Cacna1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Cacna1d APN 14 30096950 missense probably damaging 0.97
IGL00857:Cacna1d APN 14 30350681 missense possibly damaging 0.83
IGL01015:Cacna1d APN 14 30051742 splice site probably benign
IGL01420:Cacna1d APN 14 30051638 missense probably benign 0.01
IGL01470:Cacna1d APN 14 30099142 missense probably damaging 0.99
IGL01560:Cacna1d APN 14 30099206 missense probably benign 0.00
IGL01617:Cacna1d APN 14 30102371 missense probably damaging 1.00
IGL01820:Cacna1d APN 14 30042866 missense possibly damaging 0.79
IGL01948:Cacna1d APN 14 30124794 missense probably damaging 1.00
IGL02702:Cacna1d APN 14 30123533 nonsense probably null
IGL02864:Cacna1d APN 14 30051706 missense probably benign 0.10
IGL03082:Cacna1d APN 14 30099233 missense probably damaging 1.00
brisk UTSW 14 30171314 missense possibly damaging 0.91
troppo UTSW 14 30123454 missense probably damaging 1.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0015:Cacna1d UTSW 14 30114971 missense probably benign 0.00
R0033:Cacna1d UTSW 14 30105489 missense probably damaging 0.99
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0047:Cacna1d UTSW 14 30346790 splice site probably benign
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0051:Cacna1d UTSW 14 30111095 missense probably damaging 1.00
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0067:Cacna1d UTSW 14 30075010 unclassified probably benign
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0238:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0239:Cacna1d UTSW 14 30123496 missense probably benign 0.29
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0240:Cacna1d UTSW 14 30096969 missense probably benign 0.00
R0284:Cacna1d UTSW 14 30072105 missense probably damaging 1.00
R0416:Cacna1d UTSW 14 30100688 splice site probably benign
R0427:Cacna1d UTSW 14 30346817 missense probably damaging 0.99
R0517:Cacna1d UTSW 14 30179275 missense probably damaging 1.00
R0639:Cacna1d UTSW 14 30171294 critical splice donor site probably null
R0727:Cacna1d UTSW 14 30130115 critical splice donor site probably null
R0732:Cacna1d UTSW 14 30042920 missense probably damaging 0.99
R0843:Cacna1d UTSW 14 30124871 missense probably damaging 1.00
R0900:Cacna1d UTSW 14 30111082 missense probably damaging 1.00
R1278:Cacna1d UTSW 14 30178703 missense probably damaging 1.00
R1340:Cacna1d UTSW 14 30072067 missense probably damaging 0.96
R1527:Cacna1d UTSW 14 30107796 missense probably damaging 1.00
R1711:Cacna1d UTSW 14 30066056 missense probably damaging 1.00
R1736:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R1763:Cacna1d UTSW 14 30099196 missense probably benign 0.25
R2034:Cacna1d UTSW 14 30089863 missense probably damaging 1.00
R2086:Cacna1d UTSW 14 30047357 missense possibly damaging 0.83
R2126:Cacna1d UTSW 14 30123163 missense probably damaging 1.00
R2218:Cacna1d UTSW 14 30123091 missense probably damaging 1.00
R2219:Cacna1d UTSW 14 30042090 missense probably damaging 1.00
R2262:Cacna1d UTSW 14 30491016 missense possibly damaging 0.46
R2291:Cacna1d UTSW 14 30042342 missense probably damaging 1.00
R2399:Cacna1d UTSW 14 30052487 missense probably benign 0.34
R2424:Cacna1d UTSW 14 30049023 missense probably damaging 0.96
R2568:Cacna1d UTSW 14 30082511 missense probably damaging 0.99
R4038:Cacna1d UTSW 14 30066083 missense probably damaging 0.96
R4509:Cacna1d UTSW 14 30096971 missense probably damaging 1.00
R4649:Cacna1d UTSW 14 30095408 missense probably benign
R4650:Cacna1d UTSW 14 30095408 missense probably benign
R4652:Cacna1d UTSW 14 30095408 missense probably benign
R5009:Cacna1d UTSW 14 30079332 missense probably damaging 1.00
R5058:Cacna1d UTSW 14 30114244 nonsense probably null
R5063:Cacna1d UTSW 14 30051383 missense probably benign
R5138:Cacna1d UTSW 14 30490972 missense probably benign
R5151:Cacna1d UTSW 14 30123323 missense probably damaging 1.00
R5278:Cacna1d UTSW 14 30352924 critical splice donor site probably null
R5286:Cacna1d UTSW 14 30350725 missense possibly damaging 0.69
R5313:Cacna1d UTSW 14 30346841 missense probably benign 0.38
R5383:Cacna1d UTSW 14 30045279 missense possibly damaging 0.51
R5387:Cacna1d UTSW 14 30100751 missense probably damaging 1.00
R5514:Cacna1d UTSW 14 30350833 nonsense probably null
R5524:Cacna1d UTSW 14 30042129 missense probably benign 0.01
R5663:Cacna1d UTSW 14 30123340 missense probably damaging 1.00
R5712:Cacna1d UTSW 14 30074997 missense probably damaging 1.00
R5796:Cacna1d UTSW 14 30066116 missense probably damaging 1.00
R5906:Cacna1d UTSW 14 30096960 missense probably damaging 1.00
R5923:Cacna1d UTSW 14 30111148 missense probably damaging 1.00
R5936:Cacna1d UTSW 14 30171314 missense possibly damaging 0.91
R5938:Cacna1d UTSW 14 30103735 missense probably damaging 1.00
R6041:Cacna1d UTSW 14 30042357 missense probably damaging 1.00
R6432:Cacna1d UTSW 14 30123454 missense probably damaging 1.00
R6486:Cacna1d UTSW 14 30114233 missense probably benign 0.01
R6600:Cacna1d UTSW 14 30114235 missense probably benign 0.15
R6661:Cacna1d UTSW 14 30089875 missense probably damaging 1.00
R6753:Cacna1d UTSW 14 30042786 missense probably damaging 1.00
R6804:Cacna1d UTSW 14 30051665 missense probably benign 0.00
R6851:Cacna1d UTSW 14 30042782 missense probably damaging 1.00
R6863:Cacna1d UTSW 14 30075852 missense probably damaging 1.00
R6916:Cacna1d UTSW 14 30095364 missense probably damaging 1.00
R6925:Cacna1d UTSW 14 30051637 missense probably benign
R7066:Cacna1d UTSW 14 30352978 intron probably benign
R7188:Cacna1d UTSW 14 30089833 missense probably benign
R7242:Cacna1d UTSW 14 30178706 missense probably benign 0.00
R7249:Cacna1d UTSW 14 30142703 missense probably damaging 1.00
R7250:Cacna1d UTSW 14 30075151 missense probably damaging 1.00
R7274:Cacna1d UTSW 14 30142643 missense probably damaging 1.00
R7336:Cacna1d UTSW 14 30045282 missense probably benign 0.18
R7343:Cacna1d UTSW 14 30123057 missense probably benign 0.02
R7411:Cacna1d UTSW 14 30352990 start codon destroyed probably null
R7461:Cacna1d UTSW 14 30066163 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCACCAAGGGAGACTCTAGGTC -3'
(R):5'- AGTAACCTTTGGACGGTGGG -3'

Sequencing Primer
(F):5'- AGGGCTCTGTCCTCAGC -3'
(R):5'- CTGTGGCAAGGCTGATGGAG -3'
Posted On2019-06-07