Incidental Mutation 'R0590:Ksr1'
ID55935
Institutional Source Beutler Lab
Gene Symbol Ksr1
Ensembl Gene ENSMUSG00000018334
Gene Namekinase suppressor of ras 1
SynonymsD11Bhm183e, B-KSR1, D11Bhm184e
MMRRC Submission 038780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R0590 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location79013440-79146407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79045140 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 133 (S133P)
Ref Sequence ENSEMBL: ENSMUSP00000116407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018478] [ENSMUST00000108264] [ENSMUST00000129463] [ENSMUST00000141409] [ENSMUST00000208969] [ENSMUST00000226282]
Predicted Effect probably damaging
Transcript: ENSMUST00000018478
AA Change: S215P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018478
Gene: ENSMUSG00000018334
AA Change: S215P

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
Pfam:KSR1-SAM 39 166 2.7e-41 PFAM
low complexity region 271 278 N/A INTRINSIC
C1 334 377 5.48e-8 SMART
low complexity region 429 464 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Pfam:Pkinase_Tyr 563 827 2.3e-48 PFAM
Pfam:Pkinase 563 828 1.5e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108264
AA Change: S215P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103899
Gene: ENSMUSG00000018334
AA Change: S215P

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
Pfam:KSR1-SAM 39 166 8.9e-51 PFAM
low complexity region 271 278 N/A INTRINSIC
C1 334 377 5.48e-8 SMART
low complexity region 429 464 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
Pfam:Pkinase 563 637 1e-6 PFAM
Pfam:Pkinase_Tyr 563 637 2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129463
SMART Domains Protein: ENSMUSP00000114538
Gene: ENSMUSG00000018334

DomainStartEndE-ValueType
Pfam:KSR1-SAM 1 46 5.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141409
AA Change: S133P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116407
Gene: ENSMUSG00000018334
AA Change: S133P

DomainStartEndE-ValueType
Pfam:KSR1-SAM 35 84 1.6e-12 PFAM
low complexity region 189 196 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208969
AA Change: S140P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226282
AA Change: S133P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit disorganized hair follicles and a decreased susceptibility to papilloma formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat2 C T 4: 49,383,273 M93I probably benign Het
Adamts16 T C 13: 70,800,954 D196G probably benign Het
Adhfe1 T A 1: 9,548,153 probably null Het
AI661453 A G 17: 47,467,074 probably benign Het
Apc G T 18: 34,316,230 E2026* probably null Het
Atg2a GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC GCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCC 19: 6,245,007 probably benign Het
BC017158 A G 7: 128,297,470 L134P probably damaging Het
Cad T C 5: 31,062,231 S688P probably damaging Het
Ccdc191 C T 16: 43,931,341 R345* probably null Het
Dcaf13 T A 15: 39,145,085 probably benign Het
Drc1 A G 5: 30,363,136 D607G probably benign Het
Fam160a1 T C 3: 85,672,376 R841G probably benign Het
Gli1 G T 10: 127,331,563 A607E possibly damaging Het
Gls G A 1: 52,212,375 probably benign Het
Gria1 A T 11: 57,289,409 Q728H probably damaging Het
Hcrtr1 A G 4: 130,135,694 L198P probably damaging Het
Ifngr1 T A 10: 19,603,942 probably benign Het
Ipo5 T C 14: 120,944,357 V954A possibly damaging Het
Kcnh5 G T 12: 74,965,261 A628D probably damaging Het
Kif14 T C 1: 136,482,472 S646P probably damaging Het
Neb T C 2: 52,137,290 M7143V probably damaging Het
Nelfa G A 5: 33,901,825 P229S probably damaging Het
Nfatc2 T C 2: 168,571,199 T169A probably damaging Het
Nr1h4 A G 10: 89,456,567 Y398H probably damaging Het
Nrcam A G 12: 44,564,032 E511G probably damaging Het
Ocstamp T A 2: 165,397,751 R172W probably damaging Het
Olfr1130 A G 2: 87,607,994 E202G probably damaging Het
Olfr26 T A 9: 38,855,470 M136K probably damaging Het
Olfr27 T C 9: 39,144,721 V207A probably benign Het
Phf14 G A 6: 11,961,578 V405I possibly damaging Het
Plk5 G A 10: 80,360,223 R238H probably damaging Het
Pole A G 5: 110,317,926 E1240G probably benign Het
Prdm15 A G 16: 97,797,761 I899T possibly damaging Het
Psip1 T C 4: 83,458,144 N486S probably benign Het
Rlf A G 4: 121,170,833 probably benign Het
Rttn T C 18: 88,979,635 S255P probably damaging Het
Sema6c A G 3: 95,172,623 K711E probably damaging Het
Slc4a10 A T 2: 62,190,893 probably benign Het
Trim36 T G 18: 46,172,576 S435R probably benign Het
Ucp1 A G 8: 83,291,603 probably benign Het
Vmn1r17 T C 6: 57,361,014 Y122C probably benign Het
Vmn1r23 A G 6: 57,926,364 V143A probably benign Het
Wdfy4 T A 14: 33,041,174 Q2166L probably benign Het
Zc3h7b C T 15: 81,776,998 T346M possibly damaging Het
Zfhx4 T A 3: 5,402,633 V2617D probably damaging Het
Other mutations in Ksr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Ksr1 APN 11 79027517 missense probably damaging 1.00
IGL01304:Ksr1 APN 11 79027642 missense probably damaging 1.00
IGL01482:Ksr1 APN 11 79036583 missense probably damaging 1.00
IGL01928:Ksr1 APN 11 79044839 splice site probably null
IGL02025:Ksr1 APN 11 79021450 unclassified probably null
IGL02176:Ksr1 APN 11 79020791 missense probably benign 0.00
IGL02374:Ksr1 APN 11 79028491 missense probably benign 0.02
IGL02511:Ksr1 APN 11 79045220 missense possibly damaging 0.55
IGL02563:Ksr1 APN 11 79044858 missense possibly damaging 0.73
IGL02662:Ksr1 APN 11 79036725 missense probably damaging 1.00
IGL02823:Ksr1 APN 11 79021403 missense probably benign 0.35
IGL02879:Ksr1 APN 11 79074444 missense probably damaging 1.00
julius UTSW 11 79036494 critical splice donor site probably null
R0096:Ksr1 UTSW 11 79038247 splice site probably benign
R0096:Ksr1 UTSW 11 79038247 splice site probably benign
R0364:Ksr1 UTSW 11 79029025 splice site probably benign
R0479:Ksr1 UTSW 11 79025283 missense probably damaging 1.00
R0711:Ksr1 UTSW 11 79038247 splice site probably benign
R0743:Ksr1 UTSW 11 79021503 missense possibly damaging 0.79
R0884:Ksr1 UTSW 11 79021503 missense possibly damaging 0.79
R1272:Ksr1 UTSW 11 79146078 nonsense probably null
R1739:Ksr1 UTSW 11 79047305 missense probably damaging 1.00
R1885:Ksr1 UTSW 11 79020378 missense probably null
R1885:Ksr1 UTSW 11 79036521 missense probably damaging 1.00
R1886:Ksr1 UTSW 11 79020378 missense probably null
R2118:Ksr1 UTSW 11 79045193 missense probably benign 0.10
R2127:Ksr1 UTSW 11 79033313 missense probably damaging 1.00
R2939:Ksr1 UTSW 11 79045181 unclassified probably null
R4090:Ksr1 UTSW 11 79027477 missense probably damaging 1.00
R4675:Ksr1 UTSW 11 79074360 missense possibly damaging 0.81
R4854:Ksr1 UTSW 11 79027702 missense probably damaging 1.00
R5267:Ksr1 UTSW 11 79020425 missense probably damaging 1.00
R5813:Ksr1 UTSW 11 79038198 missense probably damaging 1.00
R5928:Ksr1 UTSW 11 79059719 missense probably damaging 0.96
R6199:Ksr1 UTSW 11 79020441 missense possibly damaging 0.65
R6346:Ksr1 UTSW 11 79019664 missense possibly damaging 0.93
R6377:Ksr1 UTSW 11 79036494 critical splice donor site probably null
R6885:Ksr1 UTSW 11 79047295 critical splice donor site probably null
R7016:Ksr1 UTSW 11 79027536 missense probably damaging 1.00
U24488:Ksr1 UTSW 11 79047441 missense probably damaging 1.00
Z1088:Ksr1 UTSW 11 79044879 unclassified probably null
Predicted Primers PCR Primer
(F):5'- CAACTGCATCATAGGGATGGACACC -3'
(R):5'- TGAGTGCCTTGTATTTCTGACCGAC -3'

Sequencing Primer
(F):5'- CAGTCCTTAGTATGTGCCTAAGAG -3'
(R):5'- CTGACCGACTCCTTGGC -3'
Posted On2013-07-11