Incidental Mutation 'R7192:Myo1b'
ID559622
Institutional Source Beutler Lab
Gene Symbol Myo1b
Ensembl Gene ENSMUSG00000018417
Gene Namemyosin IB
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R7192 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location51749765-51916071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51757217 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1016 (L1016P)
Ref Sequence ENSEMBL: ENSMUSP00000018561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018561] [ENSMUST00000046390] [ENSMUST00000114537] [ENSMUST00000114541]
Predicted Effect probably damaging
Transcript: ENSMUST00000018561
AA Change: L1016P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018561
Gene: ENSMUSG00000018417
AA Change: L1016P

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 4.59e0 SMART
IQ 807 829 7.07e-2 SMART
IQ 836 858 3.3e-2 SMART
Pfam:Myosin_TH1 941 1128 3e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000046390
AA Change: L987P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040447
Gene: ENSMUSG00000018417
AA Change: L987P

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 3.68e0 SMART
IQ 807 829 3.3e-2 SMART
Pfam:Myosin_TH1 911 1107 3.3e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114537
AA Change: L958P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110184
Gene: ENSMUSG00000018417
AA Change: L958P

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 1.6e0 SMART
Pfam:Myosin_TH1 882 1078 1.9e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114541
AA Change: L964P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110188
Gene: ENSMUSG00000018417
AA Change: L964P

DomainStartEndE-ValueType
MYSc 15 708 N/A SMART
IQ 709 731 2.37e-3 SMART
IQ 732 754 2.43e0 SMART
IQ 755 777 5.24e-5 SMART
IQ 784 806 1.6e0 SMART
Pfam:Myosin_TH1 888 1084 5.8e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik G A 2: 30,796,176 T329I probably damaging Het
Actl6a C A 3: 32,720,224 P290H probably damaging Het
Akap9 T A 5: 4,005,723 probably null Het
Bach1 C T 16: 87,729,663 S671L possibly damaging Het
Cacna1c T C 6: 118,656,249 I1099V Het
Cage1 G T 13: 38,019,244 P615T probably benign Het
Caskin2 C A 11: 115,801,376 R861L probably damaging Het
Cc2d2b A G 19: 40,774,437 T386A unknown Het
Ccndbp1 A G 2: 121,012,943 D272G probably damaging Het
Cep192 T A 18: 67,850,528 V1553E probably damaging Het
Chrm5 C T 2: 112,480,327 G148D probably damaging Het
Cntnap4 T C 8: 112,881,800 V1284A probably benign Het
Cpd T C 11: 76,814,841 Y355C probably damaging Het
Csmd3 C T 15: 47,704,237 V1266I Het
Cyfip2 T C 11: 46,254,666 E609G probably benign Het
Dbr1 T C 9: 99,576,702 probably null Het
Dmxl1 T C 18: 49,955,853 Y2800H probably damaging Het
Dnajc6 G T 4: 101,597,803 A64S probably benign Het
Dpp8 A T 9: 65,045,786 N248I possibly damaging Het
Dsp A T 13: 38,195,593 I2105F probably benign Het
Edem1 G A 6: 108,829,004 V89M probably benign Het
Eml4 A G 17: 83,454,461 Q528R probably benign Het
Epb42 A T 2: 121,024,097 V669D unknown Het
Fat4 A T 3: 38,980,464 Q2755L probably benign Het
Gata6 A G 18: 11,054,475 K135E possibly damaging Het
Gm36079 T A 13: 120,026,705 K103* probably null Het
Gm4788 T A 1: 139,739,295 H414L probably damaging Het
Gmeb1 A T 4: 132,227,890 F325I probably benign Het
H2-M10.3 C T 17: 36,366,559 E276K probably damaging Het
Hist1h4m A T 13: 21,812,057 K92* probably null Het
Ifi207 T C 1: 173,729,018 N718S not run Het
Il6st A G 13: 112,495,207 N427D probably benign Het
Kat7 T A 11: 95,275,830 M509L probably benign Het
Klk1b4 T C 7: 44,209,621 V21A probably benign Het
Malt1 T A 18: 65,437,827 L78Q probably benign Het
Mertk A G 2: 128,793,108 probably null Het
Neu4 A G 1: 94,025,141 I411V probably benign Het
Nutm2 A T 13: 50,473,069 D420V probably damaging Het
Olfr1364 A G 13: 21,574,369 L29P probably damaging Het
Olfr1404 T A 1: 173,216,008 M119K probably damaging Het
Olfr206 T C 16: 59,345,179 D174G probably benign Het
Olfr728 T C 14: 50,140,120 E173G possibly damaging Het
Pcdha12 C T 18: 37,020,263 R12W probably benign Het
Pdgfra G T 5: 75,183,106 D763Y probably damaging Het
Pkd2 T C 5: 104,486,657 V518A probably benign Het
Prb1 G T 6: 132,207,372 P433T unknown Het
Ptrh2 A G 11: 86,690,009 T151A probably damaging Het
Qars T A 9: 108,511,561 N273K probably damaging Het
Robo2 T C 16: 73,920,750 Y1154C probably benign Het
Rps6kc1 T A 1: 190,800,359 D482V probably damaging Het
Sec16b T C 1: 157,529,443 S74P probably benign Het
Serpinb2 A T 1: 107,524,576 I295F probably damaging Het
Sh3pxd2b T A 11: 32,414,318 D301E probably damaging Het
Sipa1l2 G A 8: 125,422,609 T1637I probably benign Het
Slc27a4 A T 2: 29,805,929 N159Y probably damaging Het
Stat1 A C 1: 52,135,621 K161Q possibly damaging Het
Stc2 T C 11: 31,369,872 probably benign Het
Strip1 A G 3: 107,615,335 W681R possibly damaging Het
Sv2a G A 3: 96,193,746 G687S probably damaging Het
Thnsl2 C T 6: 71,139,755 V138I probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Tnfrsf1a T C 6: 125,361,596 S235P unknown Het
Tpbg T A 9: 85,844,032 L18* probably null Het
Trabd2b A T 4: 114,610,020 Q482L possibly damaging Het
Trim35 T A 14: 66,297,446 F126Y probably damaging Het
Ttn A T 2: 76,827,944 V12364D unknown Het
Ubac2 A G 14: 121,973,716 Y166C probably damaging Het
Unc13b T A 4: 43,258,519 V1320D probably damaging Het
Usp34 T A 11: 23,460,571 Y2693N Het
Utp20 A T 10: 88,772,459 M1572K probably benign Het
Vmn1r7 C T 6: 57,024,467 M269I probably benign Het
Vmn2r3 C T 3: 64,259,943 G589D probably benign Het
Vrtn A T 12: 84,648,862 M129L probably damaging Het
Zfp273 A T 13: 67,825,064 T104S possibly damaging Het
Zfp384 T A 6: 125,033,312 N390K probably damaging Het
Znfx1 A G 2: 167,042,190 M933T probably benign Het
Other mutations in Myo1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myo1b APN 1 51763954 missense possibly damaging 0.94
IGL00943:Myo1b APN 1 51784487 missense probably damaging 0.97
IGL01537:Myo1b APN 1 51776351 missense possibly damaging 0.93
IGL01550:Myo1b APN 1 51784531 missense probably damaging 1.00
IGL01610:Myo1b APN 1 51776246 missense probably damaging 1.00
IGL01667:Myo1b APN 1 51760377 missense probably damaging 1.00
IGL01743:Myo1b APN 1 51782020 missense probably damaging 0.96
IGL01830:Myo1b APN 1 51797465 nonsense probably null
IGL02070:Myo1b APN 1 51794337 missense probably damaging 1.00
IGL02398:Myo1b APN 1 51757891 missense probably damaging 1.00
IGL02582:Myo1b APN 1 51781974 missense possibly damaging 0.88
IGL02685:Myo1b APN 1 51778499 missense probably damaging 1.00
IGL02938:Myo1b APN 1 51801178 splice site probably null
IGL02981:Myo1b APN 1 51778373 missense probably damaging 1.00
R0007:Myo1b UTSW 1 51776254 missense probably damaging 1.00
R0007:Myo1b UTSW 1 51776254 missense probably damaging 1.00
R0035:Myo1b UTSW 1 51778382 missense probably damaging 1.00
R0040:Myo1b UTSW 1 51781989 missense probably damaging 1.00
R0040:Myo1b UTSW 1 51781989 missense probably damaging 1.00
R0491:Myo1b UTSW 1 51755698 missense probably benign 0.05
R0959:Myo1b UTSW 1 51797087 missense probably damaging 1.00
R1171:Myo1b UTSW 1 51778525 missense probably damaging 1.00
R1440:Myo1b UTSW 1 51778558 splice site probably benign
R1539:Myo1b UTSW 1 51799563 missense probably damaging 0.97
R1616:Myo1b UTSW 1 51776315 missense probably damaging 1.00
R1888:Myo1b UTSW 1 51760403 critical splice acceptor site probably null
R1888:Myo1b UTSW 1 51760403 critical splice acceptor site probably null
R2697:Myo1b UTSW 1 51863358 missense probably benign 0.04
R3034:Myo1b UTSW 1 51773247 missense possibly damaging 0.83
R3720:Myo1b UTSW 1 51776346 missense possibly damaging 0.79
R3896:Myo1b UTSW 1 51773261 missense probably damaging 0.97
R4003:Myo1b UTSW 1 51799530 critical splice donor site probably null
R4179:Myo1b UTSW 1 51778526 missense probably damaging 1.00
R4308:Myo1b UTSW 1 51883109 missense probably benign 0.01
R4444:Myo1b UTSW 1 51757919 missense probably damaging 0.99
R4679:Myo1b UTSW 1 51757973 missense possibly damaging 0.94
R4914:Myo1b UTSW 1 51824208 splice site probably null
R5343:Myo1b UTSW 1 51778537 missense probably benign 0.00
R5530:Myo1b UTSW 1 51797423 missense probably damaging 1.00
R5636:Myo1b UTSW 1 51797528 missense probably damaging 1.00
R5956:Myo1b UTSW 1 51776232 missense probably damaging 1.00
R5974:Myo1b UTSW 1 51778373 missense probably damaging 1.00
R6334:Myo1b UTSW 1 51768651 missense probably null 0.36
R6346:Myo1b UTSW 1 51784507 missense probably damaging 1.00
R6382:Myo1b UTSW 1 51774307 splice site probably null
R6757:Myo1b UTSW 1 51813048 missense probably damaging 1.00
R6952:Myo1b UTSW 1 51762509 missense probably damaging 0.99
R7101:Myo1b UTSW 1 51758001 missense probably benign 0.19
R7347:Myo1b UTSW 1 51751254 missense probably damaging 1.00
R7446:Myo1b UTSW 1 51763906 missense possibly damaging 0.87
R7468:Myo1b UTSW 1 51797480 missense possibly damaging 0.78
R7503:Myo1b UTSW 1 51776602 intron probably null
X0065:Myo1b UTSW 1 51797395 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTAGTAGCTGAGAAATCGGAC -3'
(R):5'- GTGCAACTGTGGACACAAAC -3'

Sequencing Primer
(F):5'- TCGGACACACGAAGGAGCC -3'
(R):5'- ACATAGGTATGCTTGCTGAAAGAC -3'
Posted On2019-06-26