Incidental Mutation 'R0578:Senp5'
ID56332
Institutional Source Beutler Lab
Gene Symbol Senp5
Ensembl Gene ENSMUSG00000022772
Gene NameSUMO/sentrin specific peptidase 5
Synonyms6230429P13Rik, A730063F07Rik
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0578 (G1)
Quality Score202
Status Validated
Chromosome16
Chromosomal Location31959672-32003287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31989345 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 337 (T337S)
Ref Sequence ENSEMBL: ENSMUSP00000115257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023457] [ENSMUST00000129900] [ENSMUST00000155515] [ENSMUST00000231360]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023457
AA Change: T364S

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023457
Gene: ENSMUSG00000022772
AA Change: T364S

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
Pfam:Peptidase_C48 575 747 3.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121984
Predicted Effect possibly damaging
Transcript: ENSMUST00000129900
AA Change: T337S

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115257
Gene: ENSMUSG00000022772
AA Change: T337S

DomainStartEndE-ValueType
low complexity region 414 425 N/A INTRINSIC
Pfam:Peptidase_C48 548 603 5.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144320
Predicted Effect probably benign
Transcript: ENSMUST00000155515
SMART Domains Protein: ENSMUSP00000117481
Gene: ENSMUSG00000022772

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:Peptidase_C48 156 208 2.7e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000231360
AA Change: T364S

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232628
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP5, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Scnn1a G A 6: 125,322,244 G96S probably damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Senp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Senp5 APN 16 31989173 missense probably damaging 1.00
IGL00990:Senp5 APN 16 31990274 missense probably benign 0.00
IGL01707:Senp5 APN 16 31989770 missense probably damaging 0.99
IGL01923:Senp5 APN 16 31965816 missense probably damaging 1.00
IGL01997:Senp5 APN 16 31963470 missense probably damaging 0.97
IGL02273:Senp5 APN 16 31989872 missense probably benign 0.14
IGL02560:Senp5 APN 16 31989392 missense probably benign
IGL02651:Senp5 APN 16 31990079 missense probably benign 0.04
IGL02830:Senp5 APN 16 31983485 splice site probably benign
R1879:Senp5 UTSW 16 31983824 missense probably damaging 1.00
R2153:Senp5 UTSW 16 31968874 missense probably damaging 1.00
R4903:Senp5 UTSW 16 31983299 missense probably damaging 1.00
R5092:Senp5 UTSW 16 31989142 missense probably benign 0.00
R5590:Senp5 UTSW 16 31989513 missense probably damaging 0.99
R6346:Senp5 UTSW 16 31983847 missense probably damaging 1.00
R6362:Senp5 UTSW 16 31989884 missense probably damaging 0.99
R6762:Senp5 UTSW 16 31989884 missense probably damaging 0.99
R7002:Senp5 UTSW 16 31983775 missense probably damaging 1.00
R7027:Senp5 UTSW 16 31989295 missense probably benign
R7436:Senp5 UTSW 16 31976029 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCTCTGCTTCAGAGACCCATCC -3'
(R):5'- TGCAATCCAGTCCCTTCCCTAGAAC -3'

Sequencing Primer
(F):5'- AAGTTCTCATTCTGGGCAGGC -3'
(R):5'- CTAGAACCTAAAGATCCTTGTCGG -3'
Posted On2013-07-11