Incidental Mutation 'R0578:Scnn1a'
ID56305
Institutional Source Beutler Lab
Gene Symbol Scnn1a
Ensembl Gene ENSMUSG00000030340
Gene Namesodium channel, nonvoltage-gated 1 alpha
SynonymsENaC alpha, mENaC, Scnn1
MMRRC Submission 038768-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0578 (G1)
Quality Score130
Status Validated
Chromosome6
Chromosomal Location125320659-125344943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125322244 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 96 (G96S)
Ref Sequence ENSEMBL: ENSMUSP00000135551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081440] [ENSMUST00000175966] [ENSMUST00000176110] [ENSMUST00000176365] [ENSMUST00000176442] [ENSMUST00000176655] [ENSMUST00000177329]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081440
AA Change: G122S

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080164
Gene: ENSMUSG00000030340
AA Change: G122S

DomainStartEndE-ValueType
low complexity region 13 18 N/A INTRINSIC
Pfam:ASC 88 600 1.1e-93 PFAM
low complexity region 647 677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175966
AA Change: G96S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135551
Gene: ENSMUSG00000030340
AA Change: G96S

DomainStartEndE-ValueType
Pfam:ASC 62 264 3.5e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176110
AA Change: G96S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134940
Gene: ENSMUSG00000030340
AA Change: G96S

DomainStartEndE-ValueType
Pfam:ASC 62 575 1.9e-112 PFAM
low complexity region 621 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176365
AA Change: G80S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135467
Gene: ENSMUSG00000030340
AA Change: G80S

DomainStartEndE-ValueType
Pfam:ASC 46 141 1.8e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176442
AA Change: G15S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135336
Gene: ENSMUSG00000030340
AA Change: G15S

DomainStartEndE-ValueType
Pfam:ASC 1 494 6.3e-105 PFAM
low complexity region 540 570 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176655
AA Change: G15S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135798
Gene: ENSMUSG00000030340
AA Change: G15S

DomainStartEndE-ValueType
Pfam:ASC 1 494 6.4e-105 PFAM
low complexity region 540 570 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177329
AA Change: G96S

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134929
Gene: ENSMUSG00000030340
AA Change: G96S

DomainStartEndE-ValueType
Pfam:ASC 62 575 1.9e-112 PFAM
low complexity region 621 651 N/A INTRINSIC
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the alpha subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), a rare salt wasting disease resulting from target organ unresponsiveness to mineralocorticoids. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skin with epithelial hyperplasia, abnormal nuclei, premature lipid secretion, and abnormal keratohyaline granules. Mutants die within 40 hours of birth due to inability to clear their lungs of liquid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,059,355 Y56C possibly damaging Het
Abca5 A T 11: 110,276,489 C1500* probably null Het
Acr C G 15: 89,569,475 H72Q probably damaging Het
Adam18 T C 8: 24,641,847 D416G possibly damaging Het
Afap1l2 T A 19: 56,915,782 Y691F probably benign Het
Akna A G 4: 63,370,910 S1259P probably benign Het
Atad2 G A 15: 58,105,568 T525I probably damaging Het
Atp2a1 T G 7: 126,450,143 M576L probably benign Het
B4galt6 T C 18: 20,727,956 probably benign Het
Best3 A G 10: 117,008,999 D353G probably benign Het
Btg3 A T 16: 78,364,946 D125E probably benign Het
C87499 T A 4: 88,634,139 I2F probably benign Het
Cabin1 A T 10: 75,713,610 D1320E probably damaging Het
Cachd1 A C 4: 100,994,842 probably benign Het
Cad T C 5: 31,058,776 V151A probably benign Het
Capns1 A T 7: 30,194,028 probably benign Het
Catsperg2 T A 7: 29,704,691 T860S possibly damaging Het
Ccdc61 T C 7: 18,903,475 T76A probably benign Het
Cdipt T A 7: 126,979,530 probably null Het
Cyp2d12 G A 15: 82,556,383 probably benign Het
Dennd4c C A 4: 86,812,422 P852Q probably damaging Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dusp16 G C 6: 134,718,321 L516V probably damaging Het
Eif2ak4 T G 2: 118,474,991 probably benign Het
Faf2 C T 13: 54,621,845 A2V possibly damaging Het
Gas2l3 A G 10: 89,417,075 I236T probably damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Got1 G T 19: 43,515,783 S66R probably benign Het
Gpr149 T A 3: 62,602,689 H335L possibly damaging Het
Hadhb A G 5: 30,178,806 I342M probably benign Het
Helz T A 11: 107,686,400 V1859D unknown Het
Htr1a T A 13: 105,445,087 N278K probably damaging Het
Inppl1 T C 7: 101,831,588 E355G probably damaging Het
Isl2 A G 9: 55,545,035 Y297C probably damaging Het
Kat7 T C 11: 95,291,524 H250R probably benign Het
Klhl30 A T 1: 91,354,352 D225V probably benign Het
Mtch2 T C 2: 90,852,830 probably benign Het
Muc4 C A 16: 32,755,690 probably benign Het
Ncoa7 A C 10: 30,701,917 probably null Het
Nuf2 T A 1: 169,510,549 probably benign Het
Olfr767 A G 10: 129,079,193 Y257H probably damaging Het
Olfr994 T C 2: 85,430,673 D52G probably benign Het
Pced1a T A 2: 130,419,843 S297C probably damaging Het
Pi15 A T 1: 17,602,849 K91* probably null Het
Pla2g4e C T 2: 120,244,681 probably benign Het
Plce1 A T 19: 38,777,939 H2136L probably damaging Het
Plec A G 15: 76,176,884 L2973P probably damaging Het
Poln A G 5: 34,014,338 I695T probably damaging Het
R3hdm1 C T 1: 128,231,437 Q950* probably null Het
Rxra C T 2: 27,759,570 A429V probably damaging Het
Senp5 T A 16: 31,989,345 T337S possibly damaging Het
Smg9 A G 7: 24,415,043 D269G probably damaging Het
Srsf11 C T 3: 158,012,067 probably benign Het
Tmtc1 C T 6: 148,355,218 probably benign Het
Vmn2r19 T C 6: 123,335,972 V667A probably damaging Het
Other mutations in Scnn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Scnn1a APN 6 125338379 missense probably benign 0.11
IGL01793:Scnn1a APN 6 125343703 missense probably benign 0.03
IGL01992:Scnn1a APN 6 125338937 critical splice donor site probably null
IGL03280:Scnn1a APN 6 125342781 splice site probably benign
R0086:Scnn1a UTSW 6 125342587 splice site probably benign
R0442:Scnn1a UTSW 6 125339137 missense probably damaging 1.00
R0454:Scnn1a UTSW 6 125322226 missense probably damaging 1.00
R1538:Scnn1a UTSW 6 125338893 missense possibly damaging 0.48
R1579:Scnn1a UTSW 6 125322140 missense probably damaging 1.00
R1803:Scnn1a UTSW 6 125332194 missense probably damaging 0.98
R1876:Scnn1a UTSW 6 125338838 missense probably benign 0.05
R2113:Scnn1a UTSW 6 125337811 missense possibly damaging 0.60
R2178:Scnn1a UTSW 6 125331002 missense probably damaging 0.96
R2960:Scnn1a UTSW 6 125322293 missense probably damaging 1.00
R4072:Scnn1a UTSW 6 125338907 missense probably damaging 1.00
R4603:Scnn1a UTSW 6 125322160 missense probably damaging 1.00
R4928:Scnn1a UTSW 6 125322173 missense probably damaging 1.00
R5436:Scnn1a UTSW 6 125343022 missense possibly damaging 0.94
R6812:Scnn1a UTSW 6 125337856 missense probably benign 0.09
R7089:Scnn1a UTSW 6 125337807 missense probably benign 0.05
X0026:Scnn1a UTSW 6 125322110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAACAATTTCAAGGAGCAAGACC -3'
(R):5'- TCTCTCTGCGACTGACCTGTAAGG -3'

Sequencing Primer
(F):5'- AGGAGCAAGACCTTTGTCCTC -3'
(R):5'- CTGACCTGTAAGGATTAAGGGTGC -3'
Posted On2013-07-11