Incidental Mutation 'R7222:Trim30a'
ID568683
Institutional Source Beutler Lab
Gene Symbol Trim30a
Ensembl Gene ENSMUSG00000030921
Gene Nametripartite motif-containing 30A
SynonymsRpt-1, Rpt1, Trim30
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_009099.2; MGI:98178

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7222 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104409025-104465193 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 104421432 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076922]
PDB Structure
Solution structure of the Zinc finger, C3HC4 type (RING finger) domain Tripartite motif protein 30 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000076922
SMART Domains Protein: ENSMUSP00000076189
Gene: ENSMUSG00000030921

DomainStartEndE-ValueType
RING 15 58 2.88e-10 SMART
BBOX 91 132 3.52e-14 SMART
coiled coil region 173 241 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
Pfam:SPRY 349 493 1.6e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Homozygous null mice show increased CD4/CD8 ratio with age, an abnormal CD4+ T cell response upon TCR activation, and reduced effector function of CD4+ T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,191,693 N1151K probably benign Het
Add3 T C 19: 53,216,846 V9A unknown Het
Ankar A G 1: 72,666,355 I832T probably damaging Het
Arhgef10l C A 4: 140,521,269 W785L probably damaging Het
Atp7b G A 8: 22,022,378 Q490* probably null Het
Chrna5 A G 9: 54,998,063 D53G probably benign Het
Clip1 T A 5: 123,611,841 N993I probably damaging Het
Cyp3a59 A T 5: 146,096,575 probably null Het
Dnah3 T A 7: 120,071,523 N651Y probably benign Het
Dopey1 T C 9: 86,522,876 probably null Het
Eva1c AGGGTGTCCTGTACGAAGGACTTCCGGG AGGG 16: 90,904,184 probably benign Het
Flg T A 3: 93,288,314 S74T unknown Het
Fras1 T C 5: 96,636,186 Y850H probably damaging Het
Fras1 A T 5: 96,636,809 T884S probably benign Het
Fsip2 A G 2: 82,983,671 T3445A probably benign Het
Gm5861 T A 5: 11,183,113 N14K probably damaging Het
Gm9992 A G 17: 7,376,467 S148P probably damaging Het
Herc1 C A 9: 66,467,499 P3237H probably damaging Het
Ifi35 A G 11: 101,457,515 N123S probably benign Het
Igkv1-117 A T 6: 68,121,749 D94V probably damaging Het
Kif1b T C 4: 149,225,157 D764G probably damaging Het
Lztr1 A G 16: 17,524,132 E657G possibly damaging Het
Mmd2 G T 5: 142,567,927 L160I probably benign Het
Muc2 A T 7: 141,704,209 T15S Het
Muc6 T A 7: 141,634,515 H2835L unknown Het
Myo1h G A 5: 114,355,261 probably null Het
Olfr1173 T A 2: 88,274,465 M195L probably benign Het
Olfr1417 C A 19: 11,828,657 R123L probably damaging Het
Olfr497 A G 7: 108,422,637 D22G probably benign Het
Olfr610 A G 7: 103,506,457 V163A possibly damaging Het
Olfr658 T C 7: 104,644,730 D214G probably damaging Het
Olfr818 A G 10: 129,945,889 Y58H probably damaging Het
Olfr850 A T 9: 19,477,467 V261E probably damaging Het
Osbpl7 A G 11: 97,060,538 T684A probably damaging Het
P2ry14 T C 3: 59,115,382 K219R probably benign Het
Pde4d A T 13: 109,757,579 H156L probably damaging Het
Polq G T 16: 37,086,633 E2319* probably null Het
Ranbp3 T G 17: 56,710,211 V409G probably damaging Het
Sart3 T C 5: 113,746,656 D629G probably benign Het
Selenon T A 4: 134,547,977 T137S possibly damaging Het
Setd2 T A 9: 110,551,462 D55E Het
Slamf8 G A 1: 172,584,208 T240I possibly damaging Het
Slc39a10 A G 1: 46,819,292 L615P possibly damaging Het
Tbce T C 13: 13,998,150 D505G probably damaging Het
Tenm3 C T 8: 48,300,969 G800R probably damaging Het
Terf2ip T C 8: 112,011,915 V145A possibly damaging Het
Tmprss7 T C 16: 45,690,893 I41V probably benign Het
Traj49 A T 14: 54,168,703 N6I Het
Ubr4 T A 4: 139,463,373 S905T unknown Het
Zfp948 T A 17: 21,587,840 H431Q probably damaging Het
Zfyve1 A G 12: 83,555,005 F525L probably benign Het
Other mutations in Trim30a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02677:Trim30a APN 7 104435913 missense probably damaging 1.00
IGL02944:Trim30a APN 7 104435777 missense probably benign 0.19
IGL03135:Trim30a APN 7 104411141 missense probably damaging 0.98
R0049:Trim30a UTSW 7 104429352 critical splice acceptor site probably null
R0049:Trim30a UTSW 7 104429352 critical splice acceptor site probably null
R0682:Trim30a UTSW 7 104429182 missense probably damaging 1.00
R1773:Trim30a UTSW 7 104435901 missense probably damaging 1.00
R1862:Trim30a UTSW 7 104411198 missense probably damaging 0.99
R1872:Trim30a UTSW 7 104429210 missense probably benign 0.01
R1986:Trim30a UTSW 7 104411465 missense probably damaging 1.00
R1991:Trim30a UTSW 7 104430230 splice site probably benign
R2259:Trim30a UTSW 7 104411504 missense probably damaging 1.00
R2571:Trim30a UTSW 7 104429326 missense possibly damaging 0.93
R3719:Trim30a UTSW 7 104411163 missense probably benign 0.00
R3880:Trim30a UTSW 7 104411189 missense probably benign
R3910:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R3911:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R3912:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R4343:Trim30a UTSW 7 104435592 missense probably benign 0.00
R4572:Trim30a UTSW 7 104411188 nonsense probably null
R4587:Trim30a UTSW 7 104435644 nonsense probably null
R4997:Trim30a UTSW 7 104411620 missense probably benign 0.21
R5051:Trim30a UTSW 7 104411706 intron probably benign
R5414:Trim30a UTSW 7 104411141 missense probably damaging 1.00
R5613:Trim30a UTSW 7 104430182 missense probably damaging 1.00
R5930:Trim30a UTSW 7 104421450 missense possibly damaging 0.95
R6262:Trim30a UTSW 7 104411534 missense probably benign 0.00
R7133:Trim30a UTSW 7 104429326 missense possibly damaging 0.93
X0012:Trim30a UTSW 7 104430203 nonsense probably null
Z1088:Trim30a UTSW 7 104435654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGATCCAGCTCATTAGATATC -3'
(R):5'- TGGTCTCCAATGCCTGGTAAC -3'

Sequencing Primer
(F):5'- GATCCAGCTCATTAGATATCCATAAC -3'
(R):5'- TAAGTCAAATAAAGAGACATGCACC -3'
Posted On2019-09-11