Incidental Mutation 'R0197:Fam20c'
ID60768
Institutional Source Beutler Lab
Gene Symbol Fam20c
Ensembl Gene ENSMUSG00000025854
Gene Namefamily with sequence similarity 20, member C
SynonymsDMP4
MMRRC Submission 038456-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R0197 (G1)
Quality Score121
Status Validated
Chromosome5
Chromosomal Location138754514-138810077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138755724 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 30 (L30P)
Ref Sequence ENSEMBL: ENSMUSP00000124584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026972] [ENSMUST00000160645]
Predicted Effect probably damaging
Transcript: ENSMUST00000026972
AA Change: L30P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026972
Gene: ENSMUSG00000025854
AA Change: L30P

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
Pfam:Fam20C 349 565 4.5e-108 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160645
AA Change: L30P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124584
Gene: ENSMUSG00000025854
AA Change: L30P

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 49 63 N/A INTRINSIC
low complexity region 132 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197027
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 92.5%
  • 20x: 75.9%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of secreted protein kinases. The encoded protein binds calcium and phosphorylates proteins involved in bone mineralization. Mutations in this gene are associated with the autosomal recessive disorder Raine syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice with global conditional deletion of this gene display infertility, dwarfism, delayed bone ossification, reduced bone mineralization, fragile skeletons, hypophosphatemic rickets, and impaired osteoblast differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
2610507B11Rik A C 11: 78,269,704 probably benign Het
4930452B06Rik C T 14: 8,518,695 G254R probably damaging Het
Abcc2 A T 19: 43,826,614 R1147* probably null Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Aldh9a1 A G 1: 167,361,847 D388G probably damaging Het
Ap3d1 G T 10: 80,730,042 A97E probably damaging Het
Arhgef10 T A 8: 14,962,636 V320E probably damaging Het
Baiap2l1 C A 5: 144,266,010 V498L probably damaging Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Col4a3bp T A 13: 96,549,287 Y63N probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Dlx5 T C 6: 6,881,619 K90E possibly damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Espnl T G 1: 91,344,489 Y524D probably damaging Het
Fat1 G T 8: 45,026,553 A2879S probably benign Het
Gabrg1 A T 5: 70,774,389 V337D probably damaging Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gcc1 T C 6: 28,420,616 H234R probably damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Glt6d1 A G 2: 25,794,070 I308T probably benign Het
Gm10320 T C 13: 98,491,983 T7A probably benign Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm13088 C T 4: 143,656,440 E70K possibly damaging Het
Gmpr2 T A 14: 55,672,735 D7E possibly damaging Het
Hc A G 2: 34,984,750 Y1620H probably damaging Het
Hoxa3 T C 6: 52,170,143 probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Kdr G T 5: 75,968,422 T188N possibly damaging Het
Lepr A T 4: 101,752,152 D312V possibly damaging Het
Mcm3 A G 1: 20,810,105 V501A probably damaging Het
Mcur1 T C 13: 43,545,740 Y267C probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mroh2a G C 1: 88,246,042 A871P probably damaging Het
Ndrg2 T A 14: 51,907,003 probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr272 G A 4: 52,910,849 T315M probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Onecut2 T A 18: 64,341,472 S365T possibly damaging Het
Pds5b C A 5: 150,754,431 Q505K probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Samd3 T A 10: 26,271,854 C476S possibly damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Smpd4 T A 16: 17,641,597 probably null Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Svep1 T C 4: 58,070,851 K2312E possibly damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Usp24 T A 4: 106,407,133 W1754R probably damaging Het
Utp20 G A 10: 88,777,516 P1301L probably benign Het
Vmn2r115 T A 17: 23,359,781 S743T probably damaging Het
Vps41 T G 13: 18,854,663 probably null Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Fam20c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fam20c APN 5 138809157 missense probably benign
IGL01096:Fam20c APN 5 138809155 missense possibly damaging 0.93
IGL01393:Fam20c APN 5 138807271 missense probably damaging 1.00
IGL01576:Fam20c APN 5 138807339 missense probably damaging 0.98
IGL01960:Fam20c APN 5 138806320 missense probably damaging 0.99
IGL02317:Fam20c APN 5 138806360 missense probably damaging 1.00
IGL02979:Fam20c APN 5 138757865 missense probably damaging 1.00
IGL02988:Fam20c UTSW 5 138755994 missense probably benign 0.20
R0594:Fam20c UTSW 5 138766637 missense possibly damaging 0.94
R0615:Fam20c UTSW 5 138807486 missense probably damaging 0.99
R1672:Fam20c UTSW 5 138807301 missense probably damaging 1.00
R2044:Fam20c UTSW 5 138756227 critical splice donor site probably null
R2484:Fam20c UTSW 5 138809117 missense probably benign
R3418:Fam20c UTSW 5 138757868 missense probably damaging 0.99
R3419:Fam20c UTSW 5 138757868 missense probably damaging 0.99
R4205:Fam20c UTSW 5 138755676 missense probably damaging 1.00
R5966:Fam20c UTSW 5 138756177 missense probably damaging 1.00
R6346:Fam20c UTSW 5 138766695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAACAGAGGAGCCGCTTTGTC -3'
(R):5'- GCTGGATCTGAGCTGAAGTCTTGC -3'

Sequencing Primer
(F):5'- GCTAGTACACTGAATGGACCTTG -3'
(R):5'- TTGCAGGATGCGCAGTGT -3'
Posted On2013-07-24