Incidental Mutation 'R0715:Phf3'
ID62802
Institutional Source Beutler Lab
Gene Symbol Phf3
Ensembl Gene ENSMUSG00000048874
Gene NamePHD finger protein 3
SynonymsAU020177, 2310061N19Rik
MMRRC Submission 038898-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0715 (G1)
Quality Score139
Status Validated
Chromosome1
Chromosomal Location30802339-30873921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30811838 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1145 (L1145Q)
Ref Sequence ENSEMBL: ENSMUSP00000139610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191329]
Predicted Effect probably damaging
Transcript: ENSMUST00000088310
AA Change: L1145Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: L1145Q

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186105
Predicted Effect probably damaging
Transcript: ENSMUST00000186733
AA Change: L1145Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: L1145Q

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191245
Predicted Effect probably benign
Transcript: ENSMUST00000191329
SMART Domains Protein: ENSMUSP00000139662
Gene: ENSMUSG00000048874

DomainStartEndE-ValueType
Pfam:SPOC 1 88 1.9e-17 PFAM
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,223,092 C1933S probably benign Het
4930438A08Rik A G 11: 58,288,350 Y170C probably damaging Het
Adcy2 C T 13: 68,888,042 V167I probably benign Het
Agl A G 3: 116,752,176 Y1324H probably damaging Het
Arhgef37 G T 18: 61,508,789 Q170K probably damaging Het
Asah2 A G 19: 32,016,776 S390P probably damaging Het
Atp8a1 A T 5: 67,774,725 H240Q probably benign Het
Btbd16 T A 7: 130,788,827 N151K probably damaging Het
Ccdc73 T A 2: 104,973,154 probably benign Het
Cecr2 G T 6: 120,758,198 M21I probably benign Het
Ckap2l T C 2: 129,285,716 T181A probably benign Het
Col4a3 T C 1: 82,652,158 probably benign Het
Dnah9 A G 11: 66,081,248 probably benign Het
Fat3 T C 9: 16,375,123 T1035A probably benign Het
Fzd8 A G 18: 9,212,947 T10A unknown Het
Gm11639 T C 11: 104,720,880 L516P possibly damaging Het
Gm9631 C A 11: 121,942,502 C636F probably damaging Het
Gp1ba A G 11: 70,640,788 probably benign Het
Gsk3a A G 7: 25,231,709 V277A probably damaging Het
H2-M1 T A 17: 36,670,228 probably benign Het
Hesx1 T A 14: 27,000,852 W45R probably damaging Het
Il23r T A 6: 67,486,333 M59L possibly damaging Het
Insc T A 7: 114,845,077 V433E probably benign Het
Itga8 T C 2: 12,191,242 probably benign Het
Kif13a T A 13: 46,812,823 E436V probably damaging Het
Liph A G 16: 21,995,350 F7S probably benign Het
Lpar2 T C 8: 69,824,173 V204A probably damaging Het
Lrfn4 T A 19: 4,612,640 probably null Het
Man2b2 A T 5: 36,826,058 D182E probably benign Het
Mmp27 T C 9: 7,581,155 probably benign Het
Mrm1 A G 11: 84,814,813 probably benign Het
Mtx3 T C 13: 92,850,361 S271P probably damaging Het
Myh11 A T 16: 14,226,616 M641K possibly damaging Het
Necab2 A G 8: 119,470,931 D332G probably damaging Het
Ngfr A G 11: 95,574,239 I261T possibly damaging Het
Nrap T C 19: 56,357,325 E617G probably damaging Het
Obscn G T 11: 59,050,480 T4505K probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr983 A G 9: 40,092,511 Y148H probably damaging Het
Osbpl11 T A 16: 33,241,730 probably benign Het
Otof A G 5: 30,394,697 V301A probably damaging Het
Phospho2 T A 2: 69,796,196 I232N possibly damaging Het
Pomgnt2 T A 9: 121,982,061 K551N probably damaging Het
Ptchd3 A G 11: 121,831,158 T286A possibly damaging Het
Rnf213 A G 11: 119,441,150 D2396G probably damaging Het
Sh3pxd2b A G 11: 32,423,341 E836G possibly damaging Het
Simc1 G T 13: 54,525,655 M605I possibly damaging Het
Slc12a3 G A 8: 94,329,433 E66K possibly damaging Het
Spg11 T C 2: 122,084,983 N1060S probably benign Het
Supt5 A T 7: 28,329,037 W178R probably damaging Het
Tmem41a G T 16: 21,937,990 F126L probably benign Het
Ube2m T A 7: 13,037,626 Q35L probably benign Het
Usp33 A G 3: 152,380,574 D658G probably damaging Het
Vmn2r12 A T 5: 109,090,507 C456S probably benign Het
Vmn2r81 T A 10: 79,268,600 D352E probably damaging Het
Zfp516 A G 18: 82,987,263 Y764C probably damaging Het
Zswim7 A G 11: 62,276,647 probably benign Het
Other mutations in Phf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Phf3 APN 1 30811847 missense probably damaging 0.99
IGL00704:Phf3 APN 1 30804838 missense probably benign
IGL01147:Phf3 APN 1 30804169 missense probably damaging 1.00
IGL01360:Phf3 APN 1 30808728 missense probably damaging 1.00
IGL01376:Phf3 APN 1 30830485 missense possibly damaging 0.62
IGL01396:Phf3 APN 1 30804305 nonsense probably null
IGL01830:Phf3 APN 1 30814067 nonsense probably null
IGL02108:Phf3 APN 1 30829951 missense probably damaging 1.00
IGL02156:Phf3 APN 1 30808778 missense probably damaging 1.00
IGL02576:Phf3 APN 1 30830036 missense probably benign 0.01
IGL03031:Phf3 APN 1 30804653 missense probably benign 0.00
IGL03334:Phf3 APN 1 30805729 missense probably damaging 0.99
IGL03411:Phf3 APN 1 30804401 missense probably damaging 1.00
FR4976:Phf3 UTSW 1 30805023 utr 3 prime probably benign
PIT4458001:Phf3 UTSW 1 30816541 missense probably damaging 1.00
R0037:Phf3 UTSW 1 30804918 missense probably benign 0.03
R0052:Phf3 UTSW 1 30808767 missense probably damaging 1.00
R0114:Phf3 UTSW 1 30805443 missense possibly damaging 0.87
R0123:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0225:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0835:Phf3 UTSW 1 30830551 missense probably benign 0.02
R0848:Phf3 UTSW 1 30863172 missense probably damaging 1.00
R1473:Phf3 UTSW 1 30805940 missense probably damaging 1.00
R1522:Phf3 UTSW 1 30805648 missense probably benign 0.05
R1549:Phf3 UTSW 1 30804842 missense probably benign 0.00
R1555:Phf3 UTSW 1 30805877 missense possibly damaging 0.86
R1780:Phf3 UTSW 1 30811942 missense probably damaging 1.00
R1789:Phf3 UTSW 1 30806206 missense probably damaging 1.00
R1875:Phf3 UTSW 1 30830623 missense possibly damaging 0.81
R1912:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R1957:Phf3 UTSW 1 30831520 missense probably damaging 1.00
R2019:Phf3 UTSW 1 30811847 missense probably damaging 0.99
R2259:Phf3 UTSW 1 30804343 missense probably benign 0.20
R2305:Phf3 UTSW 1 30805475 nonsense probably null
R2345:Phf3 UTSW 1 30805351 nonsense probably null
R2424:Phf3 UTSW 1 30806349 missense probably damaging 1.00
R2497:Phf3 UTSW 1 30830014 missense probably damaging 1.00
R2504:Phf3 UTSW 1 30810789 missense probably damaging 1.00
R3522:Phf3 UTSW 1 30805603 missense probably damaging 1.00
R3816:Phf3 UTSW 1 30805753 missense probably damaging 1.00
R4152:Phf3 UTSW 1 30831458 missense probably benign 0.13
R4403:Phf3 UTSW 1 30804409 missense probably damaging 1.00
R4658:Phf3 UTSW 1 30863088 missense probably damaging 1.00
R4663:Phf3 UTSW 1 30821215 missense probably damaging 1.00
R4669:Phf3 UTSW 1 30829946 missense probably damaging 1.00
R4706:Phf3 UTSW 1 30805606 missense probably damaging 1.00
R4757:Phf3 UTSW 1 30820827 missense probably damaging 1.00
R4766:Phf3 UTSW 1 30813939 unclassified probably benign
R4786:Phf3 UTSW 1 30816557 nonsense probably null
R5107:Phf3 UTSW 1 30831485 missense probably benign 0.03
R5155:Phf3 UTSW 1 30824376 missense possibly damaging 0.87
R5310:Phf3 UTSW 1 30803806 missense probably damaging 1.00
R5823:Phf3 UTSW 1 30804683 missense probably damaging 1.00
R5944:Phf3 UTSW 1 30820704 missense probably damaging 1.00
R5979:Phf3 UTSW 1 30805746 missense probably damaging 1.00
R6007:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R6024:Phf3 UTSW 1 30863226 missense probably damaging 1.00
R6072:Phf3 UTSW 1 30830688 missense probably benign 0.08
R6533:Phf3 UTSW 1 30806318 missense probably damaging 1.00
R6649:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6653:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6852:Phf3 UTSW 1 30804630 missense probably damaging 0.97
R6855:Phf3 UTSW 1 30820123 missense probably damaging 1.00
R6862:Phf3 UTSW 1 30813982 missense probably damaging 1.00
R6930:Phf3 UTSW 1 30811877 missense probably damaging 1.00
R7135:Phf3 UTSW 1 30831109 missense possibly damaging 0.61
R7323:Phf3 UTSW 1 30813130 missense probably benign 0.01
R7352:Phf3 UTSW 1 30804326 missense possibly damaging 0.87
R7455:Phf3 UTSW 1 30837158 missense probably damaging 0.96
R7549:Phf3 UTSW 1 30831475 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAAGTCCTGTTCACTTATCCATTGGC -3'
(R):5'- TCACAGTGTGAGGAAACCACATTTCAG -3'

Sequencing Primer
(F):5'- GCCTGGGGTATACATAGTCAC -3'
(R):5'- TGCATGACAGTGTAAAACTTGC -3'
Posted On2013-07-30