Incidental Mutation 'R0801:Srgap1'
ID76290
Institutional Source Beutler Lab
Gene Symbol Srgap1
Ensembl Gene ENSMUSG00000020121
Gene NameSLIT-ROBO Rho GTPase activating protein 1
SynonymsArhgap13, 4930572H05Rik
MMRRC Submission 038981-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R0801 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121780991-122047315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121807875 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 612 (F612L)
Ref Sequence ENSEMBL: ENSMUSP00000020322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688] [ENSMUST00000161156]
PDB Structure
Crystal structure of srGAP1 SH3 domain in the slit-robo signaling pathway [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000020322
AA Change: F612L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121
AA Change: F612L

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 494 668 1.27e-64 SMART
SH3 723 778 1.57e-14 SMART
low complexity region 826 840 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081688
AA Change: F635L

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: F635L

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 517 691 1.27e-64 SMART
SH3 746 801 1.57e-14 SMART
low complexity region 849 863 N/A INTRINSIC
low complexity region 1027 1037 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161156
AA Change: F63L

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125109
Gene: ENSMUSG00000020121
AA Change: F63L

DomainStartEndE-ValueType
Pfam:RhoGAP 1 68 2.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161996
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.2%
  • 10x: 97.6%
  • 20x: 94.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030612E09Rik A G 10: 43,174,991 K94E possibly damaging Het
Aldh16a1 A T 7: 45,147,476 C228S probably benign Het
Arnt G T 3: 95,493,846 R702L possibly damaging Het
Ccdc174 A G 6: 91,895,332 E314G possibly damaging Het
Ccdc81 T C 7: 89,887,658 probably null Het
Ccdc92 T C 5: 124,836,271 T65A probably benign Het
Cenpm A T 15: 82,234,466 I149N probably benign Het
Cfap44 C T 16: 44,422,486 S751L probably benign Het
Cntrl A G 2: 35,175,095 probably benign Het
Col1a2 A G 6: 4,531,316 T762A unknown Het
Crebbp T C 16: 4,088,276 K1621E probably damaging Het
Cux1 T A 5: 136,326,929 I374L probably damaging Het
Dgkq A T 5: 108,660,720 probably null Het
Dis3l T C 9: 64,319,154 I365V probably benign Het
Dock2 T C 11: 34,708,793 R320G probably damaging Het
Dst A G 1: 34,170,389 N853S probably damaging Het
Egf T C 3: 129,702,585 probably benign Het
Eif2ak2 T A 17: 78,866,349 R267* probably null Het
Ern2 A G 7: 122,180,862 probably benign Het
Ero1lb A G 13: 12,581,687 S123G probably benign Het
Fam13a G T 6: 58,984,012 N118K probably benign Het
Gcn1l1 T A 5: 115,591,006 M792K probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf3 C T 7: 45,000,634 probably benign Het
Map2k5 T A 9: 63,357,979 probably benign Het
Mcf2l T A 8: 13,014,020 probably benign Het
Mdga2 A T 12: 66,486,733 I878K probably damaging Het
Mdn1 T C 4: 32,668,895 S318P probably benign Het
Olfr1107 G A 2: 87,072,063 Q24* probably null Het
Olfr525 G A 7: 140,322,918 C73Y probably damaging Het
Pklr G A 3: 89,145,522 W527* probably null Het
Pnpla5 T C 15: 84,113,920 M374V probably benign Het
Ptprn G T 1: 75,252,265 H835Q probably damaging Het
R3hdm4 A G 10: 79,913,357 probably benign Het
Rgs8 T A 1: 153,670,811 C19S probably damaging Het
Smarca4 C A 9: 21,642,554 Q575K possibly damaging Het
Svil A G 18: 5,099,443 R1256G probably benign Het
Tox4 T C 14: 52,279,878 S22P probably benign Het
Ttc39d A G 17: 80,216,215 Y101C probably damaging Het
Usb1 T C 8: 95,333,540 probably null Het
Vps13a T C 19: 16,686,656 probably benign Het
Vps26a G A 10: 62,459,078 probably benign Het
Zfp638 T A 6: 83,972,238 probably benign Het
Other mutations in Srgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01964:Srgap1 APN 10 121804966 missense possibly damaging 0.81
IGL02106:Srgap1 APN 10 121785693 missense possibly damaging 0.95
IGL02927:Srgap1 APN 10 121855462 missense probably damaging 0.99
IGL03088:Srgap1 APN 10 121825693 missense possibly damaging 0.94
IGL03208:Srgap1 APN 10 121792266 missense possibly damaging 0.89
IGL03251:Srgap1 APN 10 121804921 unclassified probably null
PIT1430001:Srgap1 UTSW 10 121896753 splice site probably benign
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0356:Srgap1 UTSW 10 121855536 splice site probably null
R0361:Srgap1 UTSW 10 122047192 start codon destroyed probably null 0.89
R0365:Srgap1 UTSW 10 121785705 missense possibly damaging 0.80
R0675:Srgap1 UTSW 10 121792235 missense probably damaging 1.00
R0815:Srgap1 UTSW 10 121785474 missense probably damaging 0.99
R1034:Srgap1 UTSW 10 121785445 missense possibly damaging 0.69
R1160:Srgap1 UTSW 10 121855477 missense probably benign 0.01
R1454:Srgap1 UTSW 10 121896738 missense probably damaging 0.99
R1624:Srgap1 UTSW 10 121855373 missense probably benign 0.03
R1628:Srgap1 UTSW 10 121870339 missense probably benign 0.15
R1816:Srgap1 UTSW 10 121925971 nonsense probably null
R1933:Srgap1 UTSW 10 121925903 missense possibly damaging 0.89
R2034:Srgap1 UTSW 10 121792746 missense probably damaging 0.98
R2211:Srgap1 UTSW 10 121853740 missense possibly damaging 0.55
R2295:Srgap1 UTSW 10 121794760 missense probably benign 0.03
R2368:Srgap1 UTSW 10 121829289 missense probably benign 0.05
R3796:Srgap1 UTSW 10 122047132 missense probably benign 0.06
R4083:Srgap1 UTSW 10 121785690 missense probably damaging 1.00
R4172:Srgap1 UTSW 10 121855363 missense probably benign 0.00
R4322:Srgap1 UTSW 10 121869806 missense probably damaging 1.00
R4401:Srgap1 UTSW 10 121804921 unclassified probably null
R4513:Srgap1 UTSW 10 121870326 critical splice donor site probably null
R4698:Srgap1 UTSW 10 121792487 missense probably benign 0.22
R4776:Srgap1 UTSW 10 121792351 missense probably benign 0.03
R4951:Srgap1 UTSW 10 121785552 missense probably benign 0.20
R5116:Srgap1 UTSW 10 121792379 missense possibly damaging 0.77
R5232:Srgap1 UTSW 10 121840911 missense probably benign 0.00
R5237:Srgap1 UTSW 10 121807883 missense probably damaging 1.00
R5335:Srgap1 UTSW 10 121785377 utr 3 prime probably benign
R5402:Srgap1 UTSW 10 121785760 missense probably benign 0.06
R5432:Srgap1 UTSW 10 121869823 missense probably damaging 1.00
R5456:Srgap1 UTSW 10 121869811 missense probably benign 0.45
R5669:Srgap1 UTSW 10 121804850 missense probably benign 0.00
R5682:Srgap1 UTSW 10 121805014 missense probably damaging 1.00
R5687:Srgap1 UTSW 10 121825636 missense probably damaging 1.00
R5773:Srgap1 UTSW 10 121896709 missense probably benign 0.02
R5832:Srgap1 UTSW 10 121840914 missense probably damaging 1.00
R6028:Srgap1 UTSW 10 121828730 missense probably null
R6240:Srgap1 UTSW 10 122047156 missense probably benign 0.06
R6336:Srgap1 UTSW 10 121925941 missense probably benign 0.01
R6435:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R6597:Srgap1 UTSW 10 121792371 missense probably benign 0.11
R6798:Srgap1 UTSW 10 121925904 missense probably damaging 1.00
R6807:Srgap1 UTSW 10 121828726 splice site probably null
R6897:Srgap1 UTSW 10 121785618 missense probably damaging 0.96
X0063:Srgap1 UTSW 10 121785412 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAAGAAAGCGTCCCTTCTGTCTCC -3'
(R):5'- GGACTCTGAATTGCTCAAGGCCAAG -3'

Sequencing Primer
(F):5'- CACTCAGTCACTTTGCCTGC -3'
(R):5'- tcattgggggtcacatcaag -3'
Posted On2013-10-16