Incidental Mutation 'R0926:Slc26a9'
ID83177
Institutional Source Beutler Lab
Gene Symbol Slc26a9
Ensembl Gene ENSMUSG00000042268
Gene Namesolute carrier family 26, member 9
Synonymsanion transporter/exchanger-9, E030002L01Rik
MMRRC Submission 039073-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #R0926 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131744022-131771504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 131753216 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 121 (H121P)
Ref Sequence ENSEMBL: ENSMUSP00000036916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049027] [ENSMUST00000147800] [ENSMUST00000186122]
Predicted Effect probably benign
Transcript: ENSMUST00000049027
AA Change: H121P

PolyPhen 2 Score 0.396 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036916
Gene: ENSMUSG00000042268
AA Change: H121P

DomainStartEndE-ValueType
Pfam:Sulfate_transp 71 469 7.4e-99 PFAM
transmembrane domain 473 495 N/A INTRINSIC
Pfam:STAS 520 733 2.8e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130544
Predicted Effect probably benign
Transcript: ENSMUST00000147800
AA Change: H121P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000122075
Gene: ENSMUSG00000042268
AA Change: H121P

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 56 139 5.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186122
SMART Domains Protein: ENSMUSP00000141171
Gene: ENSMUSG00000042268

DomainStartEndE-ValueType
Pfam:Sulfate_transp 150 428 9.6e-58 PFAM
low complexity region 453 462 N/A INTRINSIC
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures yet have markedly different tissue expression patterns. The product of this gene is a highly selective chloride ion channel regulated by WNK kinases. Alternative splicing results in multiple transcript variants encoding differing isoforms.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced gastric secretory membranes and loss of gastric acid secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik T C 9: 57,257,549 D514G probably damaging Het
Acbd7 A T 2: 3,340,441 I41F possibly damaging Het
Actr8 G T 14: 29,987,224 V262L probably benign Het
Anp32e A G 3: 95,937,142 D108G probably damaging Het
Banp G A 8: 122,020,555 G448S probably benign Het
Camsap3 G A 8: 3,587,960 probably null Het
Cd22 C A 7: 30,869,509 probably null Het
Cfap58 A T 19: 47,962,562 Q454L probably damaging Het
Cntn4 C T 6: 106,655,581 T522I probably benign Het
Col11a1 G A 3: 114,090,180 D233N unknown Het
Csmd1 G T 8: 16,033,576 probably null Het
Csmd3 T A 15: 47,977,033 Y946F probably damaging Het
D5Ertd579e G T 5: 36,672,866 P38Q probably damaging Het
Dnal4 T C 15: 79,762,025 T93A probably benign Het
Dsp A T 13: 38,183,218 D614V probably damaging Het
Fam160b1 G A 19: 57,381,090 A383T probably damaging Het
Fcgr1 A T 3: 96,292,366 I75N possibly damaging Het
Fgd6 T A 10: 94,135,047 Y1229N probably benign Het
Frmpd1 T G 4: 45,268,497 L214R probably damaging Het
Gapvd1 A T 2: 34,712,325 D603E probably damaging Het
H2-M9 A G 17: 36,641,773 V127A probably damaging Het
Herc2 T A 7: 56,132,548 S1328T possibly damaging Het
Ica1l T C 1: 60,006,297 N269S probably benign Het
Il18r1 T C 1: 40,487,028 Y245H probably damaging Het
Il6ra A T 3: 89,887,069 V195E probably damaging Het
Inpp5j A G 11: 3,501,439 probably benign Het
Isy1 T C 6: 87,819,143 T271A probably benign Het
Klra9 T C 6: 130,179,030 Y254C probably damaging Het
Ly6e T G 15: 74,958,370 S73A probably damaging Het
Mcmdc2 T A 1: 9,920,576 L326* probably null Het
Muc4 G A 16: 32,756,196 probably benign Het
Myh3 A G 11: 67,090,514 probably null Het
Ndor1 G A 2: 25,248,348 H409Y probably benign Het
Nwd2 A G 5: 63,807,891 D1606G probably damaging Het
Olfr1156 A T 2: 87,949,922 F104I probably damaging Het
Olfr1303 A G 2: 111,814,547 Y60H probably damaging Het
Olfr1451 A T 19: 12,999,190 D68V probably damaging Het
Olfr186 A G 16: 59,027,688 I73T possibly damaging Het
Olfr314 A G 11: 58,787,109 N292D probably damaging Het
Olfr411 G A 11: 74,347,306 R93C probably benign Het
Olfr585 T C 7: 103,097,885 L48P probably damaging Het
Paox C A 7: 140,134,038 T237K probably damaging Het
Pcmtd1 T A 1: 7,161,019 L4I probably damaging Het
Pfkl T A 10: 78,000,689 T165S probably damaging Het
Pik3ap1 A G 19: 41,302,525 S523P probably benign Het
Pitpnm1 A G 19: 4,112,338 D1056G probably damaging Het
Pitpnm2 G A 5: 124,131,209 T450I probably benign Het
Pou2f3 T C 9: 43,146,901 D37G probably damaging Het
Prdm5 A G 6: 65,883,547 H221R probably damaging Het
Pwp1 T A 10: 85,876,514 I72N probably damaging Het
Rhou A G 8: 123,660,976 E149G probably damaging Het
She A G 3: 89,851,594 probably benign Het
Spag17 A G 3: 100,072,116 D1431G probably benign Het
Trpm3 A T 19: 22,988,043 D1634V probably benign Het
Ttn A G 2: 76,797,227 probably benign Het
Zc3h14 T A 12: 98,758,590 D170E possibly damaging Het
Zcrb1 T C 15: 93,391,528 K51E probably damaging Het
Zfp110 C T 7: 12,849,881 Q819* probably null Het
Zfp616 A G 11: 74,085,818 N971S probably benign Het
Zfp827 A T 8: 79,118,192 T664S probably benign Het
Other mutations in Slc26a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Slc26a9 APN 1 131757528 missense probably damaging 0.97
IGL01131:Slc26a9 APN 1 131755542 splice site probably null
IGL01544:Slc26a9 APN 1 131759495 critical splice donor site probably null
IGL01845:Slc26a9 APN 1 131757518 missense probably damaging 0.99
IGL02125:Slc26a9 APN 1 131759437 missense probably damaging 1.00
IGL02151:Slc26a9 APN 1 131764043 missense probably damaging 1.00
IGL02267:Slc26a9 APN 1 131752845 missense probably damaging 1.00
IGL02469:Slc26a9 APN 1 131762936 missense probably damaging 0.96
IGL03137:Slc26a9 APN 1 131763877 missense probably benign 0.01
IGL03324:Slc26a9 APN 1 131764010 missense probably damaging 1.00
R0588:Slc26a9 UTSW 1 131754011 splice site probably benign
R0611:Slc26a9 UTSW 1 131762761 missense probably damaging 1.00
R0639:Slc26a9 UTSW 1 131763804 missense probably damaging 0.97
R0654:Slc26a9 UTSW 1 131765030 missense probably benign 0.00
R1109:Slc26a9 UTSW 1 131758798 missense probably benign 0.05
R1521:Slc26a9 UTSW 1 131750677 missense probably damaging 1.00
R1728:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1728:Slc26a9 UTSW 1 131766012 missense probably benign
R1729:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1729:Slc26a9 UTSW 1 131766012 missense probably benign
R1730:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1739:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1762:Slc26a9 UTSW 1 131766012 missense probably benign
R1783:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1783:Slc26a9 UTSW 1 131766012 missense probably benign
R1784:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1784:Slc26a9 UTSW 1 131766012 missense probably benign
R1785:Slc26a9 UTSW 1 131763870 missense probably benign 0.05
R1785:Slc26a9 UTSW 1 131766012 missense probably benign
R1992:Slc26a9 UTSW 1 131762794 missense probably damaging 1.00
R2198:Slc26a9 UTSW 1 131763263 splice site probably benign
R3008:Slc26a9 UTSW 1 131765914 missense probably damaging 1.00
R3409:Slc26a9 UTSW 1 131763944 missense probably benign
R3879:Slc26a9 UTSW 1 131769231 missense probably benign 0.39
R4064:Slc26a9 UTSW 1 131763187 missense probably benign 0.01
R4088:Slc26a9 UTSW 1 131767849 missense possibly damaging 0.49
R4657:Slc26a9 UTSW 1 131753138 missense probably damaging 1.00
R5005:Slc26a9 UTSW 1 131765887 missense probably damaging 0.99
R6255:Slc26a9 UTSW 1 131763909 missense probably benign 0.00
R6418:Slc26a9 UTSW 1 131758490 missense probably benign 0.06
R6442:Slc26a9 UTSW 1 131758817 missense possibly damaging 0.58
R6674:Slc26a9 UTSW 1 131765018 missense probably benign 0.01
R6719:Slc26a9 UTSW 1 131761785 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGCTCCTCAGCCAAGTTCAAAGCC -3'
(R):5'- TGCAGCAACCATCCTTTCAGGTCG -3'

Sequencing Primer
(F):5'- GCCAAGTTCAAAGCCTTTGTG -3'
(R):5'- TTCAGGTCGGATTAACATCAATCCC -3'
Posted On2013-11-08