Allele | bluebonnet | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 164,904,221 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ C (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Cd40 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | CD40 antigen | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | Tnfrsf5, p50, Bp50, Cd40 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 164,897,535-164,913,574 bp (+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TNF-receptor superfamily. The encoded protein is a receptor on antigen-presenting cells of the immune system and is essential for mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Mutations affecting this gene are the cause of autosomal recessive hyper-IgM immunodeficiency type 3 (HIGM3). Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2014] PHENOTYPE: Homozygous inactivation of this gene may cause impaired immunoglobulin class switching and germinal center formation, reduced susceptibility to type II hypersensitivity reaction, impaired priming of T cells and control of M. tuberculosis infection, and altered response to transplant. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI RefSeq: NM_011611, NM_170703, NM_170704, NM_170702; MGI:88336 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Cysteine changed to Arginine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000017799] [ENSMUSP00000073386] [ENSMUSP00000080059] [ENSMUSP00000122981] [ENSMUSP00000138707] [ENSMUSP00000139193] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P27512 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000017799 Gene: ENSMUSG00000017652 AA Change: C23R
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000073386 Gene: ENSMUSG00000017652 AA Change: C23R
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000080059 Gene: ENSMUSG00000017652 AA Change: C23R
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000122981 Gene: ENSMUSG00000017652 AA Change: C61R
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000139193 Gene: ENSMUSG00000017652 AA Change: C23R
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.0898 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 038194-MU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:45 PM by Katherine Timer | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2015-04-09 7:27 PM by Jin Huk Choi | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2015-05-14 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The bluebonnet phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R2036, some of which exhibited a null T-dependent antibody response to ovalbumin administered with aluminum hydroxide (Figure 1). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 63 mutations. The reduced T-dependent antibody response phenotype was linked by continuous variable mapping to a mutation in Cd40: a T to C transition at base pair 165,062,301 (v38) on chromosome 2, or base pair 6,698 in the GenBank genomic region NC_000068 encoding Cd40. Linkage was found with a recessive model of inheritance (P = 1.178 x 10-6), wherein 2 variant homozygotes departed phenotypically from 8 homozygous reference mice and 6 heterozygous mice (Figure 2). The mutation corresponds to residue 139 in the mRNA sequences NM_011611 (variant 1; within exon 2 of 9 total exons), NM_170703 (variant 2; within exon 2 of 8 total exons), NM_170704 (variant 4; within exon 2 of 9 total exons), and NM_170702 (variant 5; within exon 2 of 8 total exons).
Genomic numbering corresponds to NC_000068. The mutated nucleotide is indicated in red. The mutation results in an cysteine (C) to arginine (R) substitution at position 23 (C23R) in all of the isoforms of the CD40 protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.013) (1). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
CD40 (alternatively, TNFRSF5) is a member of the tumor necrosis factor receptor (TNFR) family that also includes Fas (alternatively, TNFR6; see the record for cherry) and lymphotoxin β receptor (LTβR; see the record for kama). Similar to other members of the TNFR family, CD40 is a single-pass transmembrane-spanning protein with an extracellular domain (ECD; amino acids 24-193; SMART), a transmembrane domain (TMD; amino acids 193-215), and an intracellular domain (ICD; amino acids 216-289) [Figure 3; (2)]. Amino acids 1-23 of CD40 comprise a signal peptide. CD40 has two conserved putative Asn-linked glycosylation sites at Asn153 and Asn180 (2). Within the ECD, CD40 has four cysteine-rich domains [CRDs; amino acids 26-59 (CRD1), 62-103 (CRD2), 105-143 (CRD3), and 146-186 (CRD4)]. CRDs each have six cysteine residues that associate to form three disulfide bonds. CRD1 mediates self-assembly of CD40 and is also required for CD40 expression (3). Dimerization of CD40 is proposed to be required for efficient activation of CD40 and subsequent downstream signaling. CRD2 and CRD3 are required in binding of CD40 ligand (CD40L; see the record for walla). The ICD of CD40 has several motifs that mediate interactions with downstream effectors of several signaling pathways. Amino acids 222-229 are essential for association with Janus kinase 3 (Jak3; see the record for mount tai) (4). Two distinct domains in the cytoplasmic tail, cyt-N (membrane-proximal; (Q/N/R)X(P/A)XEXX(F/W/Y); amino acids 231-238) and cyt-C [membrane-distal; (P/H)(V/I)QE(T/S); amino acids 250-254] bind to different members of the downstream signaling molecule TNF receptor-associated factor (TRAF) family and can activate NF-κB independently (5-7), although both binding sites are required for optimal NF-κB activation (4;8). TRAF1, TRAF2, TRAF3 (see the record for hulk), and TRAF5 bind to cyt-C, whereas TRAF6 binds to cyt-N (4;8;9). Upon CD40 engagement, TRAF2 and TRAF3 directly bind to the cytoplasmic tail of CD40; TRAF1 and TRAF5 are recruited to CD40 through associations with CD40-bound TRAFs (9;10). The crystal structure of a portion of the human CD40 cytoplasmic domain bound to TRAF3 has been solved [PDB:1FLL; (11)]. When bound to TRAF3, the CD40 fragment is a hairpin with two extended segments and a reverse turn centered at amino acids 258-260 (11). P250, Q252, T254 reside within a crevice across the face of the β-sandwich to directly contact TRAF3. The bluebonnet mutation results in a cysteine to arginine substitution at amino acid 23 (C23R) within the SP, which may lead to defects in protein secretion. Expression and localization of CD40bluebonnet has not been examined. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization | CD40 is constitutively expressed on the surface of mature B cells, most mature B cell malignancies, some early B cell acute lymphocytic leukemias, monocytes, dendritic cells (DCs), endothelial cells, and epithelial cells (2;4). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
The members of the TNFR superfamily regulate cell survival and death through the canonical and non-canonical NF-κB [see the records for Finlay (Nfkb1) and xander (Nfkb2), respectively] signaling pathways. CD40/CD40L provides costimulatory, activating signals to antigen presenting cells (APCs) such as B cells, macrophages, and DCs. The CD40 receptor, expressed on B cells and other APCs, is engaged by CD40L that is present primarily on activated T cells. The canonical and non-canonical NF-κB signaling pathways are activated downstream of TRAFs upon CD40L:CD40 engagement, and are major pathways for transducing the effects of CD40 activation (Figure 4). Activation of NF-κB through the classical pathway depends on degradation of IκB, thus releasing NF-κB to enter the nucleus to coordinate expression of multiple inflammatory and innate immune genes. Stimulation of CD40 also activates the non-canonical NF-κB pathway, which requires IKK-α, but not the IKK complex, and the proteasome-mediated processing of NF-κB2 (p100) to p52 (12;13). CD40 engagement results in recruitment and subsequent degradation of TRAF2 and TRAF3, destabilizing the complex with NF-κB inducing kinase (NIK) (see lucky) and permitting NIK accumulation (14-16). NIK binds and phosphorylates both IKK-α and p100 (17-19). Phosphorylation of p100 on two C-terminal sites triggers its polyubiquitination and proteasomal degradation to p52. Since p52 is typically associated with RelB, activation of the non-canonical NF-κB pathway results in nuclear translocation of p52-RelB dimers (20). In addition to NF-κB activation, CD40 also mediates its cellular effects by initiating signaling through pathways controlled by p38 MAP kinase (MAPK), c-Jun, STAT (see the record domino for information about Stat1), and Jak3, as well as PI3K and PLC-γ (see the record for queen) [reviewed in (21)]. Jak3 activation results in STAT3 phosphorylation, activation, and translocation to the nucleus. Jak3 is not required for CD40-mediated B cell proliferation, isotype switching, or upregulation of ICAM-1 or CD80 (22). However, pharmacological inhibition of Jak3 prevented the expression of costimulatory molecules and the production of IL-12 in response to CD40 stimulation of DCs (23). Several functions of CD40:CD40L are described, in brief, below. For an in-depth description of CD40:CD40L functions in humoral and cell-mediated immunity as well as CD40:CD40L-associated signaling, please see the record for walla. CD40 in humoral immunity CD40 signaling is essential for the maturation and survival of DCs, resulting in enhanced survival, secretion of cytokines such as interleukin (IL)-1, IL-6, IL-8, IL-10, IL-12, and TNFα, and upregulation of costimulatory molecules including ICAM-1 (24), LFA-3, CD80, and CD86. Conversely, crosslinking CD40L on T helper (Th) cells contributes to the generation of helper function (25). Once activated, Th cells migrate to the border between the B cell follicles and the T cell zone where they encounter antigen-activated B cells (26). CD40 induces B cell proliferation (27-29), cell-cell adhesion (30), differentiation (31;32), and tyrosine phosphorylation (33;34); B cells receive a critical costimulatory signal from T cells through CD40. The B cell response to T-dependent antigen involves engagement of CD40 on B cells and subsequent induction of costimulatory molecules (35-37). The concerted action of CD40L and Fas ligand (FasL; see the record for riogrande) on activated T cells promotes clonal proliferation of B cells stimulated by foreign antigen, whereas when B cell receptors have been desensitized by chronic stimulation with self-antigens or have not been bound by antigen CD40L and FasL trigger deletion (38). Lack of CD40L:CD40 signaling completely abolishes T-dependent humoral immunity. Study of mice deficient in either CD40 or CD40L demonstrated that CD40L:CD40 interactions are required for germinal center (GC) formation, progression, and maintenance, as well as antibody isotype switching and affinity maturation, with these processes essential for the generation of memory B cells and long-lived plasma cells (39-42). IgM responses to some T-dependent antigens were found to be impaired in CD40L-deficient mice, suggesting that CD40L:CD40 signaling is not only required for secondary Ig responses but also for primary IgM responses. Interestingly, while no GC response was observed in mice lacking CD40L:CD40 signaling, excessive CD40 stimulation during a primary immune response, either using agonistic CD40 antibodies or elevated T cell help, resulted in ablation of GC formation and premature termination of the humoral immune response, blocked the generation of B cell memory and long-lived bone marrow plasma cells, and diverted all B cells to the plasmablast lineage (43). Thus, a normal GC response requires CD40 signaling to fall within a defined range. TFH cells also depend on CD40L and IL-21 for their generation and function (44;45). CD40L:CD40 interactions are required for the initiation but not maintenance of B cell differentiation leading to Ig production (46). However, long-lived bone marrow plasma cells decreased their average affinity for antigen subsequent to blockade of CD40L (47), presumably because of disrupted interactions between cognate GC Th cells and B cells during affinity maturation in the GC. Mutations in CD40 are linked to the autosomal recessive form of immunodeficiency with hyper-IgM [HIGM3; OMIM: #606843); (48-50)]. HIGM syndromes, including HIGM1 (caused by mutations in CD40LG) and HIGM2 (caused by mutations in AID) are characterized by normal to elevated levels of IgM and low levels of IgA, IgG, and IgE, the absence of GCs, and the inability to mount a T-dependent humoral response [reviewed in (51)]. These phenotypes arise from deficient CD40L:CD40 interaction that is required for T-dependent B cell activation, as described above. As a result, HIGM1 patients suffer from recurrent bacterial infections that typically begin between the first and second years of life. These infections include a high incidence of upper and lower respiratory tract infections, otitis media, and pneumonia (52). Patients are also susceptible to developing autoimmunity, neutropenia, and lymphoproliferative diseases, and to opportunistic infections such as cryptosporidium, Pnuemocystis carinii, mycobacteria, and cytomegalovirus (CMV). T cells from a majority of HIGM1 patients exhibit reduced or absent CD40L protein expression and defective Th function despite normal CD40L mRNA levels (53). A high proportion of mutations occur in the extracellular domain (54), resulting in a range of defective binding ability for several CD40L antibodies (53). Both CD40L- and CD40-deficient mice (39-42) and some 50% of HIGM1 patients (52) display normal levels of circulating IgM, suggesting that an increased IgM level is a secondary phenotype and not a genetically determined feature of the disease. Both humans (52;55) and mice (56-58) deficient in CD40 signaling display increased susceptibility to the development of lymphomas and gastrointestinal cancers. CD40 in cell-mediated immunity CD40L and CD40 play an important role in the priming and expansion of antigen-specific Th cells. Adoptively transferred antigen-specific CD4+ T cells lacking CD40L failed to expand upon antigen challenge of the recipients (59). Expression of CD40L on T cells is required for priming of CD4+ T cells. CD40 signaling is not only required for the upregulation of costimulatory molecules and cytokine production by DCs, but also for increasing the expression and stability of the MHC:alloantigen complex (60). Signals from CD40 also promote the survival of DCs by upregulating the anti-apoptotic factor Bcl-XL in an NF-κB-dependent manner (see section on CD40 signaling below) (61). A fundamental role for CD40L:CD40 signaling in monocyte activation by T cells has also been demonstrated. Engagement of CD40 on macrophages using recombinant CD40L or CD40L-expressing cells resulted in activation of effector function, including production of the proinflammatory cytokines IL-12, IL-6, and TNF-α (62;63). However, CD40L-deficient activated Th cells failed to induce IL-12 or nitric oxide production by macrophages (64-66). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Cd40-deficient (Cd40-/-) mice were deficient in mounting an antigen-specific antibody response or to develop GCs after immunization with T-dependent antigen keyhole limpet hemocyanin (KLH) (67). The T-independent antibody response to 2,4,6-trinitrophenyl-conjugated lipopolysaccharide (TNP-LPS) and TNP-Ficoll in the Cd40-/- mice were normal (67). The loss in T-dependent antibody responses observed in the bluebonnet mice indicates a loss of CD40bluebonnet function including a failure to develop GCs in response to T-dependent antigen immunization. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer bluebonnet_pcr_F: AGTCCTGTGCATCTGTTCGG bluebonnet_pcr_R: CTTGGGGTATTCTGGCATCAAG Sequencing Primer bluebonnet_seq_F: GCTTTGGTAGATGGCAGTAAGAC bluebonnet_seq_R: TATTCTGGCATCAAGGAAGAGG |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 436 nucleotides is amplified (chromosome 2, + strand): 1 agtcctgtgc atctgttcgg attagagggt tctgcgttct tgctttggta gatggcagta Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Kuan-Wen Wang, Jin Huk Choi, Bruce Beutler |