Mutagenetix > Incidental Mutations

Incidental Mutation 'R1180:Nrbp1'

101468

Institutional Source

Beutler Lab

Gene Symbol

Nrbp1

Ensembl Gene

ENSMUSG00000029148

Gene Name

nuclear receptor binding protein 1

Synonyms

B230344L17Rik, Nrbp

MMRRC Submission

039252-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1180 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31240864-31251566 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 31245813 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 210 (I210N)

Ref Sequence

ENSEMBL: ENSMUSP00000143872 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031034] [ENSMUST00000068997] [ENSMUST00000201259] [ENSMUST00000202505] [ENSMUST00000202576] [ENSMUST00000202842]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031034
AA Change: I210N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000031034
Gene: ENSMUSG00000029148
AA Change: I210N

Domain	Start	End	E-Value	Type
low complexity region	27	60	N/A	INTRINSIC
Pfam:Pkinase_Tyr	80	324	5.8e-26	PFAM
Pfam:Pkinase	80	327	1e-26	PFAM
low complexity region	412	436	N/A	INTRINSIC
low complexity region	459	476	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000068997

SMART Domains

Protein: ENSMUSP00000070496
Gene: ENSMUSG00000055424

Domain	Start	End	E-Value	Type
low complexity region	60	76	N/A	INTRINSIC
low complexity region	78	101	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000078312
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077426
Gene: ENSMUSG00000029148
AA Change: I210N

Domain	Start	End	E-Value	Type
low complexity region	27	60	N/A	INTRINSIC
Pfam:Pkinase	79	335	1e-24	PFAM
Pfam:Pkinase_Tyr	81	332	6.5e-25	PFAM
low complexity region	420	444	N/A	INTRINSIC
low complexity region	467	484	N/A	INTRINSIC

Predicted Effect

not run
Transcript: ENSMUST00000139602
AA Change: I194N

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141973
AA Change: S309T

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200722

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201070

Predicted Effect

probably benign
Transcript: ENSMUST00000201259

Predicted Effect

probably damaging
Transcript: ENSMUST00000202505
AA Change: I125N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144292
Gene: ENSMUSG00000029148
AA Change: I125N

Domain	Start	End	E-Value	Type
STYKc	14	184	1.3e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000202576
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143872
Gene: ENSMUSG00000029148
AA Change: I210N

Domain	Start	End	E-Value	Type
low complexity region	27	60	N/A	INTRINSIC
Pfam:Pkinase	79	335	1e-24	PFAM
Pfam:Pkinase_Tyr	81	332	6.5e-25	PFAM
low complexity region	420	444	N/A	INTRINSIC
low complexity region	467	484	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202801

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202875

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202982

Predicted Effect

probably benign
Transcript: ENSMUST00000202842

SMART Domains

Protein: ENSMUSP00000143899
Gene: ENSMUSG00000029148

Domain	Start	End	E-Value	Type
Pfam:Pkinase	2	88	4.8e-5	PFAM
Pfam:Pkinase_Tyr	3	88	1.8e-7	PFAM

Meta Mutation Damage Score

0.9745

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 94.5%
20x: 87.5%

Validation Efficiency

98% (55/56)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	A	7: 41,625,717	D281E	probably benign	Het
Adam24	T	G	8: 40,681,428	V645G	probably damaging	Het
Apcdd1	A	T	18: 62,937,097	Y145F	probably damaging	Het
Cadps	A	G	14: 12,457,836		probably benign	Het
Camk1d	A	T	2: 5,362,025	Y126*	probably null	Het
Chd8	A	C	14: 52,221,108	S848A	probably damaging	Het
Col6a3	T	C	1: 90,781,855	K1873R	unknown	Het
Cpd	T	C	11: 76,801,753	T753A	possibly damaging	Het
Cxcr2	A	T	1: 74,158,368	D7V	probably benign	Het
Dock4	A	G	12: 40,640,414	E173G	possibly damaging	Het
EU599041	G	A	7: 43,226,307		noncoding transcript	Het
Fer1l6	G	A	15: 58,602,311		probably benign	Het
Flt3	T	C	5: 147,341,238	D842G	probably damaging	Het
Foxp4	G	C	17: 47,880,353		probably benign	Het
Fsip2	T	C	2: 82,975,226	Y630H	probably damaging	Het
Gprin3	C	A	6: 59,354,936	V129F	possibly damaging	Het
Gstm1	A	G	3: 108,014,811	F170S	probably damaging	Het
Hoxa3	A	C	6: 52,170,402	Y290*	probably null	Het
Htra4	G	T	8: 25,033,719	L277I	probably damaging	Het
Jak2	A	G	19: 29,282,499	Y266C	probably damaging	Het
Kif6	T	A	17: 49,832,256		probably benign	Het
Kiz	C	T	2: 146,970,007	R679C	unknown	Het
Kyat3	A	C	3: 142,737,770		probably null	Het
Mipep	G	A	14: 60,834,056	V537I	probably damaging	Het
Mrpl44	T	A	1: 79,777,960	N94K	probably damaging	Het
Mstn	A	T	1: 53,064,008	T168S	possibly damaging	Het
Mx2	G	A	16: 97,556,009	R434H	probably damaging	Het
Myh6	A	G	14: 54,944,468	I1792T	possibly damaging	Het
Myo16	T	C	8: 10,396,908	S450P	probably damaging	Het
Olfr1155	G	A	2: 87,943,146	L161F	probably benign	Het
Olfr401	A	G	11: 74,121,580	Y97C	probably benign	Het
Pdzd3	T	A	9: 44,249,246	D284V	probably benign	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Pkhd1	C	T	1: 20,585,157		probably null	Het
Psmd8	A	T	7: 29,175,400	V248E	probably benign	Het
Ranbp2	A	G	10: 58,465,463	Y646C	probably damaging	Het
Samsn1	C	T	16: 75,873,648	G189E	probably damaging	Het
Sec61g	A	C	11: 16,504,722		probably benign	Het
Sfmbt2	C	T	2: 10,402,066	H59Y	probably damaging	Het
Shb	T	C	4: 45,423,996	I486V	possibly damaging	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Spag16	G	A	1: 69,923,658		probably benign	Het
Spink13	A	G	18: 62,608,170		probably benign	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tk1	A	G	11: 117,822,095		probably null	Het
Tnni3k	A	T	3: 154,875,513	H600Q	probably damaging	Het
Ttn	A	T	2: 76,969,703	I387N	probably damaging	Het
Ube2q2	T	C	9: 55,195,416		probably benign	Het
Utp14b	C	A	1: 78,665,445	N353K	probably damaging	Het
Zfp474	C	T	18: 52,638,742	Q156*	probably null	Het

Other mutations in Nrbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00913:Nrbp1	APN	5	31251059	missense	possibly damaging	0.74
IGL00926:Nrbp1	APN	5	31243797	missense	probably benign	0.07
Ghetto	UTSW	5	31245846	critical splice donor site	probably null
pudong	UTSW	5	31250137	missense	probably damaging	1.00
Shanghai	UTSW	5	31245813	missense	probably damaging	1.00
R0358:Nrbp1	UTSW	5	31244887	missense	probably damaging	1.00
R0993:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1139:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1177:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1179:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1193:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1194:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1196:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1267:Nrbp1	UTSW	5	31250590	missense	probably benign	0.00
R1302:Nrbp1	UTSW	5	31249889	missense	probably benign	0.00
R1320:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1321:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1322:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1323:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1323:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1324:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1325:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1341:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1388:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1411:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1448:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1697:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1815:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1816:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1950:Nrbp1	UTSW	5	31245813	missense	probably damaging	1.00
R1987:Nrbp1	UTSW	5	31245391	missense	probably damaging	1.00
R2079:Nrbp1	UTSW	5	31251073	missense	probably benign	0.08
R2142:Nrbp1	UTSW	5	31247929	missense	possibly damaging	0.95
R4299:Nrbp1	UTSW	5	31250599	critical splice donor site	probably null
R5115:Nrbp1	UTSW	5	31243715	nonsense	probably null
R5168:Nrbp1	UTSW	5	31250137	missense	probably damaging	1.00
R5640:Nrbp1	UTSW	5	31249585	missense	possibly damaging	0.96
R6765:Nrbp1	UTSW	5	31245846	critical splice donor site	probably null
R7022:Nrbp1	UTSW	5	31244481	missense	probably damaging	1.00
R7044:Nrbp1	UTSW	5	31249946	missense	probably damaging	0.98
R7439:Nrbp1	UTSW	5	31244956	missense	probably damaging	1.00
R8161:Nrbp1	UTSW	5	31243849	nonsense	probably null
R8170:Nrbp1	UTSW	5	31245803	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGAGCTGGCCCTTACTCTTCTTAAC -3'
(R):5'- TTTGGCCCGAAGGACTAGAGTCAGAC -3'

Sequencing Primer
(F):5'- ACCCTTGGGTTCCCCCTG -3'
(R):5'- GAAGGACTAGAGTCAGACCTCATATC -3'

Posted On

2014-01-15