Incidental Mutation 'R1264:Clec10a'
ID151120
Institutional Source Beutler Lab
Gene Symbol Clec10a
Ensembl Gene ENSMUSG00000000318
Gene NameC-type lectin domain family 10, member A
SynonymsCD301a, Mgl1
MMRRC Submission 039331-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1264 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70156197-70170834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70169741 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 103 (S103T)
Ref Sequence ENSEMBL: ENSMUSP00000136500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000327] [ENSMUST00000102571] [ENSMUST00000144935] [ENSMUST00000152635] [ENSMUST00000153959] [ENSMUST00000178567] [ENSMUST00000178945]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000327
AA Change: S141T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000327
Gene: ENSMUSG00000000318
AA Change: S141T

DomainStartEndE-ValueType
Pfam:Lectin_N 1 164 8.5e-64 PFAM
CLECT 174 298 1.24e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102571
AA Change: S140T

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099631
Gene: ENSMUSG00000000318
AA Change: S140T

DomainStartEndE-ValueType
Pfam:Lectin_N 1 163 3.9e-65 PFAM
CLECT 173 297 1.24e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143298
Predicted Effect possibly damaging
Transcript: ENSMUST00000144935
AA Change: S103T

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136500
Gene: ENSMUSG00000000318
AA Change: S103T

DomainStartEndE-ValueType
Pfam:Lectin_N 19 126 2e-35 PFAM
CLECT 136 212 1.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150966
Predicted Effect probably benign
Transcript: ENSMUST00000152635
Predicted Effect possibly damaging
Transcript: ENSMUST00000153959
AA Change: S18T

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117772
Gene: ENSMUSG00000000318
AA Change: S18T

DomainStartEndE-ValueType
Pfam:Lectin_N 1 41 6e-19 PFAM
Pfam:Lectin_C 68 102 2.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178567
SMART Domains Protein: ENSMUSP00000136322
Gene: ENSMUSG00000000318

DomainStartEndE-ValueType
Pfam:Lectin_N 1 57 1.5e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178945
AA Change: S141T

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137447
Gene: ENSMUSG00000000318
AA Change: S141T

DomainStartEndE-ValueType
Pfam:Lectin_N 7 164 3.6e-51 PFAM
CLECT 174 292 1e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180106
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit elevated red blood cell counts but appear to be otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,646,377 probably benign Het
Acadl A T 1: 66,857,553 C27S probably benign Het
Adgrb3 C T 1: 25,559,850 G258E probably damaging Het
Akna T C 4: 63,381,725 probably null Het
Angpt2 T C 8: 18,741,217 N21S probably benign Het
Ano6 A G 15: 95,949,566 Y585C probably damaging Het
Ascc3 A T 10: 50,642,519 probably benign Het
Clstn2 T C 9: 97,457,609 R770G probably benign Het
Cndp2 C A 18: 84,678,791 C95F possibly damaging Het
Col12a1 A G 9: 79,620,089 V2653A probably benign Het
Col4a3 A T 1: 82,643,301 probably benign Het
Daam1 A G 12: 71,975,311 probably benign Het
H2-M9 A G 17: 36,642,592 V18A probably benign Het
Heatr1 T A 13: 12,424,610 probably benign Het
Impg1 T C 9: 80,314,393 D715G probably benign Het
Incenp T C 19: 9,884,015 K425E unknown Het
Kif13b T C 14: 64,776,232 probably benign Het
Msh2 T A 17: 87,707,179 probably null Het
Myh2 A G 11: 67,180,778 N474D probably damaging Het
Myo18b T C 5: 112,830,319 T1246A probably benign Het
Nob1 T C 8: 107,421,504 H102R probably damaging Het
Olfr1427 G T 19: 12,098,834 D268E probably benign Het
Pard3b A T 1: 62,164,157 I415F probably damaging Het
Pfkl T G 10: 77,993,416 K386T possibly damaging Het
Plekhs1 T C 19: 56,485,763 V447A probably benign Het
Poli C T 18: 70,517,503 V266I probably benign Het
Rapgef4 A T 2: 72,031,105 K46N possibly damaging Het
Shisa6 T C 11: 66,375,149 probably benign Het
Six3 T A 17: 85,621,857 D206E probably damaging Het
Slc12a1 A T 2: 125,218,238 E944D possibly damaging Het
Sptb A G 12: 76,612,607 F1173S probably damaging Het
Tfdp1 C A 8: 13,373,837 probably benign Het
Trrap A G 5: 144,789,599 probably benign Het
Wbp11 A G 6: 136,814,515 probably benign Het
Other mutations in Clec10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02932:Clec10a APN 11 70169728 splice site probably benign
IGL02945:Clec10a APN 11 70170542 missense possibly damaging 0.94
R1539:Clec10a UTSW 11 70169819 missense probably damaging 1.00
R2113:Clec10a UTSW 11 70169824 critical splice donor site probably null
R2567:Clec10a UTSW 11 70169532 critical splice donor site probably null
R4597:Clec10a UTSW 11 70169980 missense probably damaging 1.00
R4907:Clec10a UTSW 11 70169971 missense probably benign 0.25
R4913:Clec10a UTSW 11 70170025 missense probably damaging 1.00
R6577:Clec10a UTSW 11 70170610 missense probably benign 0.08
R7538:Clec10a UTSW 11 70169778 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TCAAAACAGGTGAGGCTGAGGTTC -3'
(R):5'- TTCATGCTCCGTCCAGTGAAGC -3'

Sequencing Primer
(F):5'- GAGGTTCCTTCTGTGCCCTG -3'
(R):5'- TTCCGAGCCTACGAAAAGC -3'
Posted On2014-01-29