Incidental Mutation 'R1259:Gm5422'
ID 151551
Institutional Source Beutler Lab
Gene Symbol Gm5422
Ensembl Gene ENSMUSG00000039684
Gene Name predicted pseudogene 5422
Synonyms
MMRRC Submission 039326-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.915) question?
Stock # R1259 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 31124133-31127039 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) T to C at 31125111 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050717
SMART Domains Protein: ENSMUSP00000135967
Gene: ENSMUSG00000039684

DomainStartEndE-ValueType
low complexity region 44 61 N/A INTRINSIC
Pfam:PC_rep 438 474 6.8e-9 PFAM
Pfam:PC_rep 475 509 1.1e-8 PFAM
SCOP:d1gw5a_ 603 760 4e-4 SMART
PDB:4CR4|Z 648 901 1e-50 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216161
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a T A 8: 44,021,684 (GRCm39) D602V probably benign Het
Adam26a T C 8: 44,021,750 (GRCm39) D580G possibly damaging Het
B4galt6 T G 18: 20,839,559 (GRCm39) E125A possibly damaging Het
Dnm1l A G 16: 16,141,870 (GRCm39) I292T possibly damaging Het
Elp3 A T 14: 65,785,388 (GRCm39) I471K probably damaging Het
Fbxw13 A T 9: 109,014,439 (GRCm39) V83E probably damaging Het
Krtap6-5 C T 16: 88,844,607 (GRCm39) R42H unknown Het
Lpcat2b C T 5: 107,581,763 (GRCm39) A364V probably damaging Het
Ltbp1 A G 17: 75,532,280 (GRCm39) Q118R possibly damaging Het
Lypd9 A G 11: 58,338,296 (GRCm39) I32T probably benign Het
Med7 C G 11: 46,331,460 (GRCm39) I18M probably damaging Het
Muc6 T A 7: 141,226,464 (GRCm39) probably benign Het
Or8b42 T A 9: 38,342,169 (GRCm39) L197Q probably damaging Het
Or8k16 T A 2: 85,519,875 (GRCm39) I34N probably damaging Het
Pbrm1 T C 14: 30,796,771 (GRCm39) F871L probably damaging Het
Pgbd5 T A 8: 125,097,324 (GRCm39) D493V probably damaging Het
Pik3cd G A 4: 149,735,105 (GRCm39) R1046* probably null Het
Pom121l2 G A 13: 22,166,297 (GRCm39) W189* probably null Het
Prex2 C A 1: 11,359,494 (GRCm39) N1567K probably damaging Het
Prl A G 13: 27,245,472 (GRCm39) probably null Het
Ptpro T C 6: 137,369,739 (GRCm39) V517A probably damaging Het
Rfwd3 C T 8: 112,014,874 (GRCm39) R326Q probably damaging Het
Tenm2 C T 11: 35,954,004 (GRCm39) G1236R possibly damaging Het
Vmn2r12 T A 5: 109,239,763 (GRCm39) I267F probably damaging Het
Wasf3 T C 5: 146,388,786 (GRCm39) V80A probably damaging Het
Other mutations in Gm5422
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Gm5422 APN 10 31,125,432 (GRCm39) exon noncoding transcript
IGL01569:Gm5422 APN 10 31,125,897 (GRCm39) exon noncoding transcript
IGL01645:Gm5422 APN 10 31,126,069 (GRCm39) exon noncoding transcript
IGL02273:Gm5422 APN 10 31,126,003 (GRCm39) exon noncoding transcript
IGL02603:Gm5422 APN 10 31,125,436 (GRCm39) exon noncoding transcript
IGL02928:Gm5422 APN 10 31,126,250 (GRCm39) exon noncoding transcript
IGL03003:Gm5422 APN 10 31,126,840 (GRCm39) exon noncoding transcript
IGL03274:Gm5422 APN 10 31,126,348 (GRCm39) exon noncoding transcript
IGL03297:Gm5422 APN 10 31,125,727 (GRCm39) exon noncoding transcript
ANU23:Gm5422 UTSW 10 31,125,432 (GRCm39) exon noncoding transcript
R0010:Gm5422 UTSW 10 31,125,750 (GRCm39) exon noncoding transcript
R0506:Gm5422 UTSW 10 31,126,318 (GRCm39) exon noncoding transcript
R0560:Gm5422 UTSW 10 31,125,240 (GRCm39) exon noncoding transcript
R0573:Gm5422 UTSW 10 31,126,156 (GRCm39) exon noncoding transcript
R0652:Gm5422 UTSW 10 31,125,277 (GRCm39) exon noncoding transcript
R1210:Gm5422 UTSW 10 31,126,719 (GRCm39) intron noncoding transcript
R1352:Gm5422 UTSW 10 31,126,731 (GRCm39) intron noncoding transcript
R1631:Gm5422 UTSW 10 31,125,802 (GRCm39) exon noncoding transcript
R1707:Gm5422 UTSW 10 31,124,458 (GRCm39) exon noncoding transcript
R1893:Gm5422 UTSW 10 31,125,609 (GRCm39) exon noncoding transcript
R2011:Gm5422 UTSW 10 31,124,764 (GRCm39) exon noncoding transcript
R2132:Gm5422 UTSW 10 31,124,929 (GRCm39) exon noncoding transcript
R3427:Gm5422 UTSW 10 31,124,842 (GRCm39) exon noncoding transcript
R3772:Gm5422 UTSW 10 31,124,510 (GRCm39) exon noncoding transcript
R4703:Gm5422 UTSW 10 31,125,608 (GRCm39) exon noncoding transcript
R5539:Gm5422 UTSW 10 31,124,646 (GRCm39) exon noncoding transcript
R5603:Gm5422 UTSW 10 31,126,840 (GRCm39) exon noncoding transcript
R5660:Gm5422 UTSW 10 31,126,048 (GRCm39) exon noncoding transcript
R6124:Gm5422 UTSW 10 31,125,396 (GRCm39) exon noncoding transcript
R6178:Gm5422 UTSW 10 31,125,688 (GRCm39) exon noncoding transcript
R8263:Gm5422 UTSW 10 31,125,099 (GRCm39) missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGTTCCGAAAGTTTAGCCGTTTCCC -3'
(R):5'- GCCATTTGTTGCCATCATCAGTCAG -3'

Sequencing Primer
(F):5'- CCTGAATCTCTGAGATTGGCAC -3'
(R):5'- TTATCTTGACCAAAGGCGGC -3'
Posted On 2014-01-29