Incidental Mutation 'R1210:Gm5422'
ID100654
Institutional Source Beutler Lab
Gene Symbol Gm5422
Ensembl Gene ENSMUSG00000039684
Gene Namepredicted pseudogene 5422
Synonyms
MMRRC Submission 039279-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R1210 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location31248140-31251045 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 31250723 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050717
SMART Domains Protein: ENSMUSP00000135967
Gene: ENSMUSG00000039684

DomainStartEndE-ValueType
low complexity region 44 61 N/A INTRINSIC
Pfam:PC_rep 438 474 6.8e-9 PFAM
Pfam:PC_rep 475 509 1.1e-8 PFAM
SCOP:d1gw5a_ 603 760 4e-4 SMART
PDB:4CR4|Z 648 901 1e-50 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216161
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 93.9%
  • 20x: 83.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Clec7a T C 6: 129,465,525 I180V probably damaging Het
Csf3 A G 11: 98,702,477 D140G probably damaging Het
Cwf19l2 T C 9: 3,430,810 S381P probably benign Het
Eef1b2 A G 1: 63,177,273 D21G probably damaging Het
Fam83a A T 15: 57,995,248 Y228F possibly damaging Het
Itga5 A G 15: 103,357,473 V149A possibly damaging Het
Lrrfip1 A G 1: 91,115,193 H440R probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mindy4 T A 6: 55,284,813 L569H possibly damaging Het
Mme A G 3: 63,343,606 K356R probably benign Het
Nfkb1 A G 3: 135,594,927 I626T probably benign Het
Olfr1186 G C 2: 88,526,276 R231P possibly damaging Het
Olfr172 T C 16: 58,761,050 N42S probably damaging Het
Olfr38 T C 6: 42,762,667 V205A possibly damaging Het
Olfr720 T C 14: 14,176,029 T18A probably benign Het
Rock2 T A 12: 16,965,469 V789D probably damaging Het
Sav1 A G 12: 69,969,179 Y282H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r89 T C 14: 51,454,970 F77L probably benign Het
Vps50 G A 6: 3,594,884 V816I probably damaging Het
Other mutations in Gm5422
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Gm5422 APN 10 31249436 exon noncoding transcript
IGL01569:Gm5422 APN 10 31249901 exon noncoding transcript
IGL01645:Gm5422 APN 10 31250073 exon noncoding transcript
IGL02273:Gm5422 APN 10 31250007 exon noncoding transcript
IGL02603:Gm5422 APN 10 31249440 exon noncoding transcript
IGL02928:Gm5422 APN 10 31250254 exon noncoding transcript
IGL03003:Gm5422 APN 10 31250844 exon noncoding transcript
IGL03274:Gm5422 APN 10 31250352 exon noncoding transcript
IGL03297:Gm5422 APN 10 31249731 exon noncoding transcript
ANU23:Gm5422 UTSW 10 31249436 exon noncoding transcript
R0010:Gm5422 UTSW 10 31249754 exon noncoding transcript
R0506:Gm5422 UTSW 10 31250322 exon noncoding transcript
R0560:Gm5422 UTSW 10 31249244 exon noncoding transcript
R0573:Gm5422 UTSW 10 31250160 exon noncoding transcript
R0652:Gm5422 UTSW 10 31249281 exon noncoding transcript
R1259:Gm5422 UTSW 10 31249115 exon noncoding transcript
R1352:Gm5422 UTSW 10 31250735 intron noncoding transcript
R1631:Gm5422 UTSW 10 31249806 exon noncoding transcript
R1707:Gm5422 UTSW 10 31248462 exon noncoding transcript
R1893:Gm5422 UTSW 10 31249613 exon noncoding transcript
R2011:Gm5422 UTSW 10 31248768 exon noncoding transcript
R2132:Gm5422 UTSW 10 31248933 exon noncoding transcript
R3427:Gm5422 UTSW 10 31248846 exon noncoding transcript
R3772:Gm5422 UTSW 10 31248514 exon noncoding transcript
R4703:Gm5422 UTSW 10 31249612 exon noncoding transcript
R5539:Gm5422 UTSW 10 31248650 exon noncoding transcript
R5603:Gm5422 UTSW 10 31250844 exon noncoding transcript
R5660:Gm5422 UTSW 10 31250052 exon noncoding transcript
R6124:Gm5422 UTSW 10 31249400 exon noncoding transcript
R6178:Gm5422 UTSW 10 31249692 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGACACATTTAGGGAAGGGCACAC -3'
(R):5'- TCATAGCAGGCACAACAGCGTG -3'

Sequencing Primer
(F):5'- TTTAGGGAAGGGCACACTTACC -3'
(R):5'- AGCCAGGGTCTCTAGAAGC -3'
Posted On2014-01-15