Incidental Mutation 'R1234:Samd4b'
ID152385
Institutional Source Beutler Lab
Gene Symbol Samd4b
Ensembl Gene ENSMUSG00000109336
Gene Namesterile alpha motif domain containing 4B
Synonyms
MMRRC Submission 039302-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock #R1234 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28399522-28598144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28414010 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 177 (G177R)
Ref Sequence ENSEMBL: ENSMUSP00000146984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040531] [ENSMUST00000207766] [ENSMUST00000208199]
Predicted Effect probably damaging
Transcript: ENSMUST00000040531
AA Change: G177R

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336
AA Change: G177R

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207766
AA Change: G177R

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000208199
AA Change: G177R

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208676
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Cd300e T A 11: 115,055,366 I90F probably damaging Het
Cyr61 A G 3: 145,649,839 probably benign Het
Dclk1 T C 3: 55,489,877 I528T probably damaging Het
Dnajc13 T C 9: 104,214,157 N645S possibly damaging Het
Efhb A T 17: 53,451,587 Y340* probably null Het
Fhod1 T C 8: 105,337,163 probably benign Het
Hk2 G A 6: 82,760,248 H28Y possibly damaging Het
Hmcn1 G A 1: 150,753,654 R951* probably null Het
Mapkapk2 G A 1: 131,055,776 R334* probably null Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Psg18 A T 7: 18,349,190 S347T probably damaging Het
Ptk6 C T 2: 181,202,440 R22Q possibly damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Ssrp1 T C 2: 85,042,263 F415S probably damaging Het
Stab1 A G 14: 31,150,236 L1198P probably damaging Het
Tcf23 T C 5: 30,970,222 Y123H probably damaging Het
Vars2 T C 17: 35,667,146 N43S probably damaging Het
Vmn2r79 A T 7: 87,004,099 E524V possibly damaging Het
Xrcc1 T C 7: 24,567,845 V373A possibly damaging Het
Other mutations in Samd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Samd4b APN 7 28401877 missense probably damaging 1.00
IGL00979:Samd4b APN 7 28414213 missense probably damaging 1.00
IGL01336:Samd4b APN 7 28413963 missense probably benign 0.00
IGL01432:Samd4b APN 7 28414066 missense possibly damaging 0.60
IGL01895:Samd4b APN 7 28401909 critical splice acceptor site probably null
IGL02827:Samd4b APN 7 28414121 missense probably damaging 1.00
IGL03077:Samd4b APN 7 28406443 missense probably damaging 0.99
IGL03055:Samd4b UTSW 7 28405546 missense possibly damaging 0.89
R0367:Samd4b UTSW 7 28423448 missense probably damaging 1.00
R0390:Samd4b UTSW 7 28403977 missense probably benign 0.13
R0440:Samd4b UTSW 7 28408160 missense probably benign 0.45
R0488:Samd4b UTSW 7 28414237 missense probably damaging 1.00
R0798:Samd4b UTSW 7 28401623 splice site probably benign
R1233:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1481:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1643:Samd4b UTSW 7 28423616 missense probably damaging 1.00
R1675:Samd4b UTSW 7 28414010 missense probably damaging 0.98
R1768:Samd4b UTSW 7 28413892 missense probably benign 0.36
R1801:Samd4b UTSW 7 28407331 splice site probably null
R2831:Samd4b UTSW 7 28403913 missense probably damaging 0.99
R4505:Samd4b UTSW 7 28407500 missense probably benign 0.15
R4507:Samd4b UTSW 7 28407500 missense probably benign 0.15
R4731:Samd4b UTSW 7 28406663 missense probably benign 0.00
R5811:Samd4b UTSW 7 28408020 missense probably damaging 1.00
R6063:Samd4b UTSW 7 28423631 start codon destroyed possibly damaging 0.71
R6114:Samd4b UTSW 7 28522792 unclassified probably null
R6356:Samd4b UTSW 7 28401593 missense probably damaging 1.00
R6467:Samd4b UTSW 7 28401860 missense probably damaging 1.00
R7055:Samd4b UTSW 7 28404033 missense probably benign 0.01
R7191:Samd4b UTSW 7 28414261 missense probably benign 0.18
R7371:Samd4b UTSW 7 28423501 missense probably benign 0.33
R7445:Samd4b UTSW 7 28406456 missense probably benign 0.00
R7543:Samd4b UTSW 7 28414286 missense probably benign 0.02
R7663:Samd4b UTSW 7 28423500 nonsense probably null
R7746:Samd4b UTSW 7 28403903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGGGACTTGCCAAGCACAG -3'
(R):5'- TTCATTGAGGAGAGCCGCCAAC -3'

Sequencing Primer
(F):5'- TTGCCAAGCACAGAGCAAG -3'
(R):5'- GAGAGCCGCCAACTCCTC -3'
Posted On2014-01-29