Incidental Mutation 'R1334:Mon1a'
ID 156817
Institutional Source Beutler Lab
Gene Symbol Mon1a
Ensembl Gene ENSMUSG00000032583
Gene Name MON1 homolog A, secretory traffciking associated
Synonyms 2810468K17Rik
MMRRC Submission 039399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1334 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 107888151-107903139 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 107901363 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 262 (N262T)
Ref Sequence ENSEMBL: ENSMUSP00000141516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035202] [ENSMUST00000191906]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000035202
AA Change: N262T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035202
Gene: ENSMUSG00000032583
AA Change: N262T

DomainStartEndE-ValueType
Pfam:Mon1 151 555 1.2e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158380
Predicted Effect probably damaging
Transcript: ENSMUST00000191906
AA Change: N262T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141516
Gene: ENSMUSG00000032583
AA Change: N262T

DomainStartEndE-ValueType
Pfam:Mon1 146 461 1.1e-138 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,775,722 probably null Het
Amph G A 13: 19,142,028 V643M probably damaging Het
Bnc2 T C 4: 84,276,289 E933G possibly damaging Het
Ccdc69 A T 11: 55,052,979 H75Q probably damaging Het
Ccdc81 C T 7: 89,866,561 E637K probably benign Het
Cpa3 T C 3: 20,222,223 E282G probably damaging Het
Cpxm1 G A 2: 130,393,563 P503L probably damaging Het
Dnah7b T C 1: 46,322,335 F3465S probably damaging Het
Dnaja3 T C 16: 4,699,794 S297P probably damaging Het
Enpp4 C A 17: 44,102,368 V92L probably benign Het
Fndc3b A T 3: 27,458,851 Y709N probably damaging Het
H2-Eb2 T G 17: 34,334,350 V170G probably damaging Het
Hmcn1 C T 1: 150,586,468 G5153D possibly damaging Het
Ldah T C 12: 8,284,089 probably null Het
Micu1 T C 10: 59,788,976 L280P probably damaging Het
Nim1k A G 13: 119,712,488 I290T probably benign Het
Olfr1109 T C 2: 87,093,227 T57A probably damaging Het
Olfr357 A T 2: 36,996,860 I17F probably benign Het
Olfr47 A G 6: 43,235,965 Y119C probably benign Het
Pcdhb12 C T 18: 37,436,671 T290I probably damaging Het
Pkhd1 T G 1: 20,533,905 D1187A possibly damaging Het
Primpol T C 8: 46,586,391 Y398C probably damaging Het
Prob1 T C 18: 35,653,252 T650A possibly damaging Het
Rasl12 G A 9: 65,410,869 V172M probably damaging Het
Rgs5 G A 1: 169,682,817 probably null Het
St14 T C 9: 31,108,210 Y105C probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Ttn T C 2: 76,745,043 T16842A probably damaging Het
Ttn T C 2: 76,812,972 E13201G probably damaging Het
Vwa5a C A 9: 38,734,741 N468K probably benign Het
Other mutations in Mon1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Mon1a APN 9 107902684 missense probably damaging 1.00
IGL02104:Mon1a APN 9 107901615 missense probably damaging 1.00
IGL02223:Mon1a APN 9 107901285 missense probably damaging 1.00
IGL02268:Mon1a APN 9 107901798 missense possibly damaging 0.95
R1708:Mon1a UTSW 9 107898718 missense probably benign 0.27
R1753:Mon1a UTSW 9 107901363 missense probably damaging 0.99
R3774:Mon1a UTSW 9 107901303 missense probably damaging 1.00
R4964:Mon1a UTSW 9 107902651 missense probably damaging 1.00
R4966:Mon1a UTSW 9 107902651 missense probably damaging 1.00
R5586:Mon1a UTSW 9 107898695 missense probably damaging 0.99
R5636:Mon1a UTSW 9 107901240 missense probably damaging 1.00
R6816:Mon1a UTSW 9 107900410 missense probably damaging 1.00
R7080:Mon1a UTSW 9 107901786 missense probably damaging 1.00
R7709:Mon1a UTSW 9 107900128 missense probably benign 0.05
R7820:Mon1a UTSW 9 107901312 missense probably damaging 1.00
R8263:Mon1a UTSW 9 107898794 missense probably benign
R9083:Mon1a UTSW 9 107902636 missense probably damaging 1.00
R9750:Mon1a UTSW 9 107901579 missense probably damaging 1.00
RF009:Mon1a UTSW 9 107901234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACAAGGTAGTATTCGTGCGCC -3'
(R):5'- TGCAAAGAAGTCCTCACGGTCAG -3'

Sequencing Primer
(F):5'- TATTCGTGCGCCGGAGC -3'
(R):5'- TGAACTTTGGCAGGCACAC -3'
Posted On 2014-02-11