Incidental Mutation 'R1353:Capn9'
ID157099
Institutional Source Beutler Lab
Gene Symbol Capn9
Ensembl Gene ENSMUSG00000031981
Gene Namecalpain 9
SynonymsGC36, nCL-4
MMRRC Submission 039418-MU
Accession Numbers

Genbank: NM_023709; MGI: 1920897

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1353 (G1)
Quality Score203
Status Not validated
Chromosome8
Chromosomal Location124576111-124618731 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to C at 124605566 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093033]
Predicted Effect probably null
Transcript: ENSMUST00000093033
SMART Domains Protein: ENSMUSP00000090717
Gene: ENSMUSG00000031981

DomainStartEndE-ValueType
CysPc 24 345 1.53e-196 SMART
calpain_III 348 494 1.91e-87 SMART
low complexity region 504 522 N/A INTRINSIC
EFh 565 593 1.25e-2 SMART
EFh 595 623 2.64e-1 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.1%
  • 20x: 86.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains are ubiquitous, well-conserved family of calcium-dependent, cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large subunit possesses a cysteine protease domain, and both subunits possess calcium-binding domains. Calpains have been implicated in neurodegenerative processes, as their activation can be triggered by calcium influx and oxidative stress. The protein encoded by this gene is expressed predominantly in stomach and small intestine and may have specialized functions in the digestive tract. This gene is thought to be associated with gastric cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to ethanol-induced gastric mucosa injury. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Astn2 T C 4: 66,266,335 Q175R unknown Het
Car9 G T 4: 43,512,439 probably null Het
Chd7 A G 4: 8,839,556 N1364S probably damaging Het
Cmya5 A T 13: 93,041,525 V3607E probably damaging Het
Crb2 T C 2: 37,787,281 C262R probably damaging Het
Cyp2t4 A G 7: 27,156,630 N204S probably benign Het
Epha1 T C 6: 42,361,837 T676A probably damaging Het
Fancm G A 12: 65,088,170 V246M probably damaging Het
Fcrl5 T C 3: 87,448,362 S461P probably damaging Het
Gen1 A T 12: 11,243,219 L394Q probably benign Het
Gm13757 T C 2: 88,446,551 H129R probably benign Het
Hsdl2 G T 4: 59,596,971 probably null Het
Klri2 C T 6: 129,739,086 G97S probably damaging Het
Lypla2 T C 4: 135,970,467 I55V probably null Het
Malrd1 A G 2: 16,127,968 D1900G unknown Het
Map1b A G 13: 99,427,326 S2378P unknown Het
March3 A T 18: 56,776,105 probably null Het
Myom2 G T 8: 15,106,424 W757L probably damaging Het
Nat10 T A 2: 103,754,073 M120L possibly damaging Het
Ncam2 T G 16: 81,200,915 M1R probably null Het
Ncoa4 G T 14: 32,170,858 G33* probably null Het
Olfr3 C A 2: 36,812,914 M59I possibly damaging Het
Olfr434 T A 6: 43,217,690 M259K probably benign Het
Olfr54 G A 11: 51,027,006 M1I probably null Het
Olfr768 C T 10: 129,093,864 V37I probably benign Het
Olfr890 A C 9: 38,143,728 I198L probably benign Het
Osbpl8 A G 10: 111,276,479 N485S probably damaging Het
Pkdrej A T 15: 85,818,918 V939E probably damaging Het
Plaa T C 4: 94,571,689 E607G possibly damaging Het
Rtel1 T A 2: 181,349,231 C285S probably benign Het
Rtl1 A C 12: 109,592,199 C1069G probably benign Het
Rtn4 C A 11: 29,707,595 A583E probably damaging Het
Runx1 T A 16: 92,689,051 R32* probably null Het
Sdcbp A G 4: 6,381,057 I67M probably damaging Het
Slc22a12 G C 19: 6,537,782 L259V possibly damaging Het
Sptlc2 A G 12: 87,341,746 S321P probably damaging Het
Tmem30c C T 16: 57,277,665 G131D probably damaging Het
Tnfaip2 A T 12: 111,444,969 Q9L probably damaging Het
Ttn T C 2: 76,746,566 Y24661C probably damaging Het
Vmn2r77 T G 7: 86,802,186 F427V probably benign Het
Zcchc4 A G 5: 52,807,077 I292V probably benign Het
Zfp354b A T 11: 50,923,413 H228Q probably damaging Het
Zfp84 T A 7: 29,776,175 N97K probably benign Het
Zfp976 T C 7: 42,616,018 D49G probably damaging Het
Zgrf1 C T 3: 127,611,803 T1550I probably damaging Het
Other mutations in Capn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Capn9 APN 8 124591769 missense probably benign
IGL01987:Capn9 APN 8 124576226 missense probably benign 0.01
IGL02150:Capn9 APN 8 124613843 missense probably benign 0.01
IGL02348:Capn9 APN 8 124594677 missense probably damaging 1.00
IGL02720:Capn9 APN 8 124600497 splice site probably benign
IGL02723:Capn9 APN 8 124609183 splice site probably benign
IGL03065:Capn9 APN 8 124605559 missense probably damaging 1.00
IGL03169:Capn9 APN 8 124605877 missense probably damaging 1.00
A2778:Capn9 UTSW 8 124605478 missense possibly damaging 0.95
R0288:Capn9 UTSW 8 124600491 splice site probably benign
R1611:Capn9 UTSW 8 124611512 missense possibly damaging 0.90
R1672:Capn9 UTSW 8 124613831 missense probably benign 0.03
R1682:Capn9 UTSW 8 124611565 splice site probably null
R1729:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1739:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1762:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1783:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1784:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1785:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R1836:Capn9 UTSW 8 124605565 critical splice donor site probably null
R1883:Capn9 UTSW 8 124611558 missense probably benign
R1924:Capn9 UTSW 8 124576226 missense probably benign 0.01
R2008:Capn9 UTSW 8 124591685 missense probably damaging 1.00
R2049:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2069:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2131:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2141:Capn9 UTSW 8 124605711 missense possibly damaging 0.90
R2219:Capn9 UTSW 8 124609159 nonsense probably null
R4193:Capn9 UTSW 8 124600486 missense probably null 0.00
R4707:Capn9 UTSW 8 124613456 missense possibly damaging 0.82
R5092:Capn9 UTSW 8 124597525 missense probably damaging 1.00
R5386:Capn9 UTSW 8 124605540 missense possibly damaging 0.83
R5697:Capn9 UTSW 8 124589071 missense unknown
R5734:Capn9 UTSW 8 124605844 missense probably damaging 1.00
R5999:Capn9 UTSW 8 124589078 missense probably damaging 1.00
R6026:Capn9 UTSW 8 124605862 missense probably damaging 1.00
R6298:Capn9 UTSW 8 124617454 missense probably benign
R6787:Capn9 UTSW 8 124616185 missense probably benign 0.00
R6856:Capn9 UTSW 8 124597569 missense probably damaging 1.00
R7131:Capn9 UTSW 8 124576278 missense probably damaging 1.00
R7149:Capn9 UTSW 8 124605709 missense probably benign 0.00
RF015:Capn9 UTSW 8 124618482 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACGGCAGACACCTTCTGGAC -3'
(R):5'- ACTGAGAAAGATGGGCTCTCTCACC -3'

Sequencing Primer
(F):5'- TTCTGGACCAACCCTCAGATAAAG -3'
(R):5'- TTCTCAGAGAAGATTCTCAGGCAG -3'
Posted On2014-02-11