Incidental Mutation 'R1311:Mtpn'
ID157930
Institutional Source Beutler Lab
Gene Symbol Mtpn
Ensembl Gene ENSMUSG00000029840
Gene Namemyotrophin
SynonymsGcdp, V1, 5033418D15Rik
MMRRC Submission 039377-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R1311 (G1)
Quality Score186
Status Validated
Chromosome6
Chromosomal Location35508906-35539888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35512250 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 113 (I113T)
Ref Sequence ENSEMBL: ENSMUSP00000031866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031866]
PDB Structure Solution NMR structure of V-1 bound to capping protein (CP) [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031866
AA Change: I113T

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031866
Gene: ENSMUSG00000029840
AA Change: I113T

DomainStartEndE-ValueType
Blast:ANK 1 30 8e-9 BLAST
ANK 34 63 7.64e-6 SMART
ANK 67 96 1.14e-4 SMART
Meta Mutation Damage Score 0.9079 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.1%
  • 20x: 86.2%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transcript produced from this gene is bi-cistronic and can encode both myotrophin and leucine zipper protein 6. The myotrophin protein is associated with cardiac hypertrophy, where it is involved in the conversion of NFkappa B p50-p65 heterodimers to p50-p50 and p65-p65 homodimers. This protein also has a potential function in cerebellar morphogenesis, and it may be involved in the differentiation of cerebellar neurons, particularly of granule cells. A cryptic ORF at the 3' end of this transcript uses a novel internal ribosome entry site and a non-AUG translation initiation codon to produce leucine zipper protein 6, a 6.4 kDa tumor antigen that is associated with myeloproliferative disease. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1c T C 2: 58,280,249 Q449R probably benign Het
Cap1 A G 4: 122,865,214 Y195H possibly damaging Het
Casp8ap2 T A 4: 32,648,111 N1939K probably damaging Het
Cd209c T A 8: 3,945,908 M1L probably benign Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Col13a1 A G 10: 61,864,010 probably benign Het
Dennd4a T C 9: 64,910,004 V1640A probably benign Het
Eml6 T C 11: 29,831,088 probably benign Het
Fat3 G A 9: 16,021,410 T1409I probably damaging Het
Gm4884 G C 7: 41,043,115 E169D possibly damaging Het
Gm5709 T C 3: 59,618,679 noncoding transcript Het
Htr2b C A 1: 86,110,624 A87S probably damaging Het
Kansl2 G T 15: 98,528,916 H275N possibly damaging Het
Megf6 G A 4: 154,263,782 probably null Het
Myh6 G T 14: 54,946,365 A1704E probably damaging Het
Notum C T 11: 120,655,749 probably benign Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfml1 T C 7: 107,567,896 probably null Het
Olfr295 T A 7: 86,585,953 V226D probably damaging Het
Ptpn5 A T 7: 47,079,232 probably benign Het
Rapgef2 A G 3: 79,083,547 F985L probably benign Het
Slc7a7 A T 14: 54,373,030 Y386* probably null Het
Snph G T 2: 151,597,202 P36Q probably damaging Het
St18 T C 1: 6,845,644 C838R probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Supt7l T C 5: 31,520,261 Y187C probably damaging Het
Sycp2l A T 13: 41,135,185 K241* probably null Het
Tenm2 G T 11: 36,068,594 probably benign Het
Tfap4 A G 16: 4,559,426 probably null Het
Tmem132e T C 11: 82,444,296 Y643H probably damaging Het
Tmem200c A T 17: 68,840,763 S114C probably damaging Het
Ush2a T C 1: 188,947,145 I4850T possibly damaging Het
Zmym6 G T 4: 127,123,358 L977F probably damaging Het
Other mutations in Mtpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Mtpn APN 6 35522776 missense probably damaging 0.96
IGL00957:Mtpn APN 6 35539612 utr 5 prime probably benign
IGL03238:Mtpn APN 6 35522773 missense probably damaging 1.00
lamco UTSW 6 35522758 missense possibly damaging 0.65
R0972:Mtpn UTSW 6 35521976 missense probably null 0.78
R1462:Mtpn UTSW 6 35522758 missense possibly damaging 0.65
R1462:Mtpn UTSW 6 35522758 missense possibly damaging 0.65
R3076:Mtpn UTSW 6 35521944 missense possibly damaging 0.67
R5297:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5334:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5336:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5337:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5512:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5809:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5841:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5842:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5843:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5844:Mtpn UTSW 6 35512290 missense probably benign 0.00
R5846:Mtpn UTSW 6 35512290 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGAGCTGAGAAGGTCCAATGATTC -3'
(R):5'- CCTATGCCACATAGCCACCTCTGG -3'

Sequencing Primer
(F):5'- GCTCTCCCTTGGGAATAAGCTG -3'
(R):5'- ATAGCCACCTCTGGCACTTG -3'
Posted On2014-02-18