Incidental Mutation 'R1478:Fam19a2'
ID165641
Institutional Source Beutler Lab
Gene Symbol Fam19a2
Ensembl Gene ENSMUSG00000044071
Gene Namefamily with sequence similarity 19, member A2
SynonymsTafa-2
MMRRC Submission 039531-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1478 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location123263996-123741204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123593496 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 5 (M5K)
Ref Sequence ENSEMBL: ENSMUSP00000050199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050756]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050756
AA Change: M5K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050199
Gene: ENSMUSG00000044071
AA Change: M5K

DomainStartEndE-ValueType
Pfam:TAFA 45 133 6.8e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219723
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety-like and fear-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,056 L170Q probably damaging Het
Aacs T A 5: 125,503,223 I204N possibly damaging Het
Acaca A G 11: 84,372,627 T2025A probably damaging Het
B4galt3 C T 1: 171,276,365 R170C probably benign Het
BC028528 T C 3: 95,891,959 probably null Het
Ccdc73 A T 2: 104,907,610 Q17L possibly damaging Het
Ccdc73 A G 2: 104,914,667 T50A possibly damaging Het
Ccdc83 T C 7: 90,259,469 D19G probably damaging Het
Cct8l1 T C 5: 25,517,769 V494A probably benign Het
Chd1 T C 17: 15,739,507 F663L probably damaging Het
Chn2 A T 6: 54,293,080 E319V probably damaging Het
Cnnm1 T C 19: 43,471,856 V679A probably damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Cyp3a11 G T 5: 145,858,771 L457I probably benign Het
Dera T A 6: 137,830,195 S214T possibly damaging Het
Dmtf1 A G 5: 9,121,404 V501A possibly damaging Het
Dnpep A G 1: 75,316,027 V114A probably damaging Het
Dscam C T 16: 96,790,910 V722M probably benign Het
Dsp A G 13: 38,181,138 N499S probably damaging Het
Ecd A T 14: 20,346,657 Y53* probably null Het
Esyt3 T C 9: 99,318,066 T692A probably benign Het
Fat1 T A 8: 45,025,622 N2545K probably damaging Het
Fndc3a A G 14: 72,557,632 probably null Het
Fscn3 A G 6: 28,430,568 M246V probably benign Het
Gde1 G T 7: 118,691,784 T106K probably benign Het
Gjc2 A G 11: 59,177,608 I16T possibly damaging Het
Hacd4 A T 4: 88,423,023 M168K probably damaging Het
Hmx3 A G 7: 131,544,097 E178G probably damaging Het
Htt A G 5: 34,803,827 Y266C probably damaging Het
Kif27 G T 13: 58,303,545 R990S probably damaging Het
Krtap22-2 A T 16: 89,010,646 Y21* probably null Het
Lrrc41 T A 4: 116,095,208 L661* probably null Het
Lrrc63 T C 14: 75,125,984 T236A probably benign Het
Mmp13 T C 9: 7,272,892 L84P probably damaging Het
Myh8 T C 11: 67,292,725 I754T probably benign Het
Neb A C 2: 52,175,607 D5961E probably benign Het
Nlrx1 T C 9: 44,264,077 H134R probably benign Het
Npepps A T 11: 97,226,847 M542K probably benign Het
Nup160 C T 2: 90,679,399 probably benign Het
Olfr402 T A 11: 74,155,137 probably null Het
Olfr952 T A 9: 39,426,592 T160S possibly damaging Het
Pikfyve T C 1: 65,262,977 probably null Het
Ppp6r1 A T 7: 4,640,378 probably null Het
Prss33 A G 17: 23,835,098 W45R probably damaging Het
Ptprf A T 4: 118,212,105 Y980* probably null Het
Qrich1 T C 9: 108,559,332 V743A probably benign Het
Rev3l G A 10: 39,783,333 probably null Het
Samd9l A T 6: 3,376,369 N297K probably benign Het
Sap130 A G 18: 31,680,474 H528R possibly damaging Het
Slc9b2 T C 3: 135,326,102 V241A probably benign Het
Snx14 A T 9: 88,394,528 V577E probably benign Het
Srrm2 T C 17: 23,815,902 S507P probably benign Het
Stat2 A G 10: 128,282,100 probably null Het
Susd5 T C 9: 114,096,684 F545S probably benign Het
Tnnt2 A G 1: 135,848,026 T107A probably benign Het
Trappc6b T A 12: 59,048,167 I41F possibly damaging Het
Ttn T A 2: 76,852,073 probably benign Het
Vmn1r88 A C 7: 13,177,951 D78A probably damaging Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Xpc C T 6: 91,508,528 D122N possibly damaging Het
Xpo1 C T 11: 23,291,623 A890V probably damaging Het
Zfp493 A G 13: 67,786,561 H211R probably damaging Het
Zfp958 A T 8: 4,629,190 H405L probably damaging Het
Other mutations in Fam19a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
dolorous UTSW 10 123704392 missense probably damaging 1.00
lugubrious UTSW 10 123593496 missense possibly damaging 0.86
R0395:Fam19a2 UTSW 10 123593592 missense probably benign 0.05
R2869:Fam19a2 UTSW 10 123704365 missense possibly damaging 0.63
R2869:Fam19a2 UTSW 10 123704365 missense possibly damaging 0.63
R2870:Fam19a2 UTSW 10 123704365 missense possibly damaging 0.63
R2870:Fam19a2 UTSW 10 123704365 missense possibly damaging 0.63
R2873:Fam19a2 UTSW 10 123704365 missense possibly damaging 0.63
R6537:Fam19a2 UTSW 10 123593496 missense possibly damaging 0.86
R6589:Fam19a2 UTSW 10 123704392 missense probably damaging 1.00
R6972:Fam19a2 UTSW 10 123704373 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGTCATAGCAACATGCTTCATTTGGA -3'
(R):5'- AGAAAATTGCTAAGGGGAACCCATACC -3'

Sequencing Primer
(F):5'- aacaaccacacaatcaccaac -3'
(R):5'- GGGGAACCCATACCTAATAAAATTG -3'
Posted On2014-03-28