Incidental Mutation 'R1478:Lrrc41'
ID165605
Institutional Source Beutler Lab
Gene Symbol Lrrc41
Ensembl Gene ENSMUSG00000028703
Gene Nameleucine rich repeat containing 41
SynonymsD730026A16Rik, MUF1, D630045E04Rik
MMRRC Submission 039531-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.482) question?
Stock #R1478 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116075269-116097043 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 116095208 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 661 (L661*)
Ref Sequence ENSEMBL: ENSMUSP00000030471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030471] [ENSMUST00000102704] [ENSMUST00000102705]
Predicted Effect probably null
Transcript: ENSMUST00000030471
AA Change: L661*
SMART Domains Protein: ENSMUSP00000030471
Gene: ENSMUSG00000028703
AA Change: L661*

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 352 382 N/A INTRINSIC
low complexity region 417 429 N/A INTRINSIC
SCOP:d1yrga_ 449 742 4e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102704
SMART Domains Protein: ENSMUSP00000099765
Gene: ENSMUSG00000028702

DomainStartEndE-ValueType
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102705
SMART Domains Protein: ENSMUSP00000099766
Gene: ENSMUSG00000028702

DomainStartEndE-ValueType
Pfam:Rad54_N 10 138 7.8e-9 PFAM
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139147
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,056 L170Q probably damaging Het
Aacs T A 5: 125,503,223 I204N possibly damaging Het
Acaca A G 11: 84,372,627 T2025A probably damaging Het
B4galt3 C T 1: 171,276,365 R170C probably benign Het
BC028528 T C 3: 95,891,959 probably null Het
Ccdc73 A T 2: 104,907,610 Q17L possibly damaging Het
Ccdc73 A G 2: 104,914,667 T50A possibly damaging Het
Ccdc83 T C 7: 90,259,469 D19G probably damaging Het
Cct8l1 T C 5: 25,517,769 V494A probably benign Het
Chd1 T C 17: 15,739,507 F663L probably damaging Het
Chn2 A T 6: 54,293,080 E319V probably damaging Het
Cnnm1 T C 19: 43,471,856 V679A probably damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Cyp3a11 G T 5: 145,858,771 L457I probably benign Het
Dera T A 6: 137,830,195 S214T possibly damaging Het
Dmtf1 A G 5: 9,121,404 V501A possibly damaging Het
Dnpep A G 1: 75,316,027 V114A probably damaging Het
Dscam C T 16: 96,790,910 V722M probably benign Het
Dsp A G 13: 38,181,138 N499S probably damaging Het
Ecd A T 14: 20,346,657 Y53* probably null Het
Esyt3 T C 9: 99,318,066 T692A probably benign Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fat1 T A 8: 45,025,622 N2545K probably damaging Het
Fndc3a A G 14: 72,557,632 probably null Het
Fscn3 A G 6: 28,430,568 M246V probably benign Het
Gde1 G T 7: 118,691,784 T106K probably benign Het
Gjc2 A G 11: 59,177,608 I16T possibly damaging Het
Hacd4 A T 4: 88,423,023 M168K probably damaging Het
Hmx3 A G 7: 131,544,097 E178G probably damaging Het
Htt A G 5: 34,803,827 Y266C probably damaging Het
Kif27 G T 13: 58,303,545 R990S probably damaging Het
Krtap22-2 A T 16: 89,010,646 Y21* probably null Het
Lrrc63 T C 14: 75,125,984 T236A probably benign Het
Mmp13 T C 9: 7,272,892 L84P probably damaging Het
Myh8 T C 11: 67,292,725 I754T probably benign Het
Neb A C 2: 52,175,607 D5961E probably benign Het
Nlrx1 T C 9: 44,264,077 H134R probably benign Het
Npepps A T 11: 97,226,847 M542K probably benign Het
Nup160 C T 2: 90,679,399 probably benign Het
Olfr402 T A 11: 74,155,137 probably null Het
Olfr952 T A 9: 39,426,592 T160S possibly damaging Het
Pikfyve T C 1: 65,262,977 probably null Het
Ppp6r1 A T 7: 4,640,378 probably null Het
Prss33 A G 17: 23,835,098 W45R probably damaging Het
Ptprf A T 4: 118,212,105 Y980* probably null Het
Qrich1 T C 9: 108,559,332 V743A probably benign Het
Rev3l G A 10: 39,783,333 probably null Het
Samd9l A T 6: 3,376,369 N297K probably benign Het
Sap130 A G 18: 31,680,474 H528R possibly damaging Het
Slc9b2 T C 3: 135,326,102 V241A probably benign Het
Snx14 A T 9: 88,394,528 V577E probably benign Het
Srrm2 T C 17: 23,815,902 S507P probably benign Het
Stat2 A G 10: 128,282,100 probably null Het
Susd5 T C 9: 114,096,684 F545S probably benign Het
Tnnt2 A G 1: 135,848,026 T107A probably benign Het
Trappc6b T A 12: 59,048,167 I41F possibly damaging Het
Ttn T A 2: 76,852,073 probably benign Het
Vmn1r88 A C 7: 13,177,951 D78A probably damaging Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Xpc C T 6: 91,508,528 D122N possibly damaging Het
Xpo1 C T 11: 23,291,623 A890V probably damaging Het
Zfp493 A G 13: 67,786,561 H211R probably damaging Het
Zfp958 A T 8: 4,629,190 H405L probably damaging Het
Other mutations in Lrrc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Lrrc41 APN 4 116096466 missense probably damaging 0.97
IGL01358:Lrrc41 APN 4 116075587 missense probably benign 0.16
IGL01734:Lrrc41 APN 4 116093134 critical splice donor site probably null
IGL01986:Lrrc41 APN 4 116089322 missense probably benign 0.27
IGL02159:Lrrc41 APN 4 116088486 missense probably benign 0.03
IGL02892:Lrrc41 APN 4 116088835 missense possibly damaging 0.68
IGL03135:Lrrc41 APN 4 116088531 missense probably benign
R1765:Lrrc41 UTSW 4 116089051 missense possibly damaging 0.94
R2233:Lrrc41 UTSW 4 116096385 missense possibly damaging 0.66
R4080:Lrrc41 UTSW 4 116080546 splice site probably null
R4677:Lrrc41 UTSW 4 116095135 missense probably benign
R4833:Lrrc41 UTSW 4 116093177 unclassified probably benign
R4877:Lrrc41 UTSW 4 116079405 missense probably damaging 0.99
R4926:Lrrc41 UTSW 4 116089324 missense possibly damaging 0.46
R6459:Lrrc41 UTSW 4 116088780 missense possibly damaging 0.95
R6817:Lrrc41 UTSW 4 116089305 missense possibly damaging 0.66
R6834:Lrrc41 UTSW 4 116096529 missense possibly damaging 0.46
R7479:Lrrc41 UTSW 4 116089041 missense probably damaging 0.96
R7512:Lrrc41 UTSW 4 116092994 missense possibly damaging 0.66
R7593:Lrrc41 UTSW 4 116092944 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGCTTGTGTTGCAAACACTCAAAGG -3'
(R):5'- ACCAAGGTGCTACCACCATTTCTG -3'

Sequencing Primer
(F):5'- TTGCAAACACTCAAAGGTAGGAATG -3'
(R):5'- GCTACCACCATTTCTGACAGC -3'
Posted On2014-03-28