Incidental Mutation 'R1478:Myh8'
ID165645
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Namemyosin, heavy polypeptide 8, skeletal muscle, perinatal
SynonymsMyhsp, 4832426G23Rik, MyHC-pn, Myhs-p
MMRRC Submission 039531-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.816) question?
Stock #R1478 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67277124-67308634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67292725 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 754 (I754T)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
Predicted Effect probably benign
Transcript: ENSMUST00000019625
AA Change: I754T

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: I754T

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139052
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931417E11Rik A T 6: 73,469,056 L170Q probably damaging Het
Aacs T A 5: 125,503,223 I204N possibly damaging Het
Acaca A G 11: 84,372,627 T2025A probably damaging Het
B4galt3 C T 1: 171,276,365 R170C probably benign Het
BC028528 T C 3: 95,891,959 probably null Het
Ccdc73 A T 2: 104,907,610 Q17L possibly damaging Het
Ccdc73 A G 2: 104,914,667 T50A possibly damaging Het
Ccdc83 T C 7: 90,259,469 D19G probably damaging Het
Cct8l1 T C 5: 25,517,769 V494A probably benign Het
Chd1 T C 17: 15,739,507 F663L probably damaging Het
Chn2 A T 6: 54,293,080 E319V probably damaging Het
Cnnm1 T C 19: 43,471,856 V679A probably damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Cyp3a11 G T 5: 145,858,771 L457I probably benign Het
Dera T A 6: 137,830,195 S214T possibly damaging Het
Dmtf1 A G 5: 9,121,404 V501A possibly damaging Het
Dnpep A G 1: 75,316,027 V114A probably damaging Het
Dscam C T 16: 96,790,910 V722M probably benign Het
Dsp A G 13: 38,181,138 N499S probably damaging Het
Ecd A T 14: 20,346,657 Y53* probably null Het
Esyt3 T C 9: 99,318,066 T692A probably benign Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fat1 T A 8: 45,025,622 N2545K probably damaging Het
Fndc3a A G 14: 72,557,632 probably null Het
Fscn3 A G 6: 28,430,568 M246V probably benign Het
Gde1 G T 7: 118,691,784 T106K probably benign Het
Gjc2 A G 11: 59,177,608 I16T possibly damaging Het
Hacd4 A T 4: 88,423,023 M168K probably damaging Het
Hmx3 A G 7: 131,544,097 E178G probably damaging Het
Htt A G 5: 34,803,827 Y266C probably damaging Het
Kif27 G T 13: 58,303,545 R990S probably damaging Het
Krtap22-2 A T 16: 89,010,646 Y21* probably null Het
Lrrc41 T A 4: 116,095,208 L661* probably null Het
Lrrc63 T C 14: 75,125,984 T236A probably benign Het
Mmp13 T C 9: 7,272,892 L84P probably damaging Het
Neb A C 2: 52,175,607 D5961E probably benign Het
Nlrx1 T C 9: 44,264,077 H134R probably benign Het
Npepps A T 11: 97,226,847 M542K probably benign Het
Nup160 C T 2: 90,679,399 probably benign Het
Olfr402 T A 11: 74,155,137 probably null Het
Olfr952 T A 9: 39,426,592 T160S possibly damaging Het
Pikfyve T C 1: 65,262,977 probably null Het
Ppp6r1 A T 7: 4,640,378 probably null Het
Prss33 A G 17: 23,835,098 W45R probably damaging Het
Ptprf A T 4: 118,212,105 Y980* probably null Het
Qrich1 T C 9: 108,559,332 V743A probably benign Het
Rev3l G A 10: 39,783,333 probably null Het
Samd9l A T 6: 3,376,369 N297K probably benign Het
Sap130 A G 18: 31,680,474 H528R possibly damaging Het
Slc9b2 T C 3: 135,326,102 V241A probably benign Het
Snx14 A T 9: 88,394,528 V577E probably benign Het
Srrm2 T C 17: 23,815,902 S507P probably benign Het
Stat2 A G 10: 128,282,100 probably null Het
Susd5 T C 9: 114,096,684 F545S probably benign Het
Tnnt2 A G 1: 135,848,026 T107A probably benign Het
Trappc6b T A 12: 59,048,167 I41F possibly damaging Het
Ttn T A 2: 76,852,073 probably benign Het
Vmn1r88 A C 7: 13,177,951 D78A probably damaging Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Xpc C T 6: 91,508,528 D122N possibly damaging Het
Xpo1 C T 11: 23,291,623 A890V probably damaging Het
Zfp493 A G 13: 67,786,561 H211R probably damaging Het
Zfp958 A T 8: 4,629,190 H405L probably damaging Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL01020:Myh8 APN 11 67283403 missense probably damaging 0.99
IGL01348:Myh8 APN 11 67297780 missense probably damaging 1.00
IGL01382:Myh8 APN 11 67301973 missense probably damaging 1.00
IGL01454:Myh8 APN 11 67283596 missense probably damaging 1.00
IGL01457:Myh8 APN 11 67292679 missense probably benign 0.00
IGL01472:Myh8 APN 11 67288379 splice site probably benign
IGL01473:Myh8 APN 11 67301825 critical splice donor site probably null
IGL01613:Myh8 APN 11 67301710 missense probably benign 0.11
IGL01763:Myh8 APN 11 67286419 missense probably benign 0.01
IGL01828:Myh8 APN 11 67303826 missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67289694 nonsense probably null
IGL01905:Myh8 APN 11 67284651 missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67283372 unclassified probably benign
IGL02386:Myh8 APN 11 67294440 missense probably damaging 0.99
IGL02449:Myh8 APN 11 67294614 critical splice donor site probably null
IGL02500:Myh8 APN 11 67305710 missense probably benign 0.00
IGL02745:Myh8 APN 11 67297501 missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67301592 splice site probably benign
IGL03063:Myh8 APN 11 67288205 missense probably benign 0.00
IGL03223:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL03336:Myh8 APN 11 67284702 missense probably damaging 1.00
IGL03338:Myh8 APN 11 67298346 missense probably damaging 1.00
IGL03351:Myh8 APN 11 67303913 missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67294418 missense probably damaging 1.00
PIT4354001:Myh8 UTSW 11 67289630 missense probably benign 0.01
R0012:Myh8 UTSW 11 67300021 missense probably benign 0.02
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0115:Myh8 UTSW 11 67306264 splice site probably benign
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0132:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0393:Myh8 UTSW 11 67306017 splice site probably benign
R0453:Myh8 UTSW 11 67292905 missense probably benign 0.03
R0454:Myh8 UTSW 11 67303765 nonsense probably null
R0466:Myh8 UTSW 11 67298579 missense probably benign 0.01
R0487:Myh8 UTSW 11 67302011 missense probably benign
R0511:Myh8 UTSW 11 67284507 missense probably benign 0.01
R0557:Myh8 UTSW 11 67301798 missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67298627 missense probably benign 0.00
R0658:Myh8 UTSW 11 67284532 critical splice donor site probably null
R0782:Myh8 UTSW 11 67289754 missense probably benign 0.16
R0829:Myh8 UTSW 11 67283500 unclassified probably benign
R0845:Myh8 UTSW 11 67286264 missense probably damaging 1.00
R0930:Myh8 UTSW 11 67305998 missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67297759 missense probably damaging 1.00
R1132:Myh8 UTSW 11 67297131 nonsense probably null
R1417:Myh8 UTSW 11 67306185 missense probably damaging 1.00
R1497:Myh8 UTSW 11 67289812 missense probably benign 0.00
R1605:Myh8 UTSW 11 67301671 missense probably damaging 0.99
R1701:Myh8 UTSW 11 67280138 missense probably damaging 1.00
R1950:Myh8 UTSW 11 67279004 missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67292724 missense probably benign 0.00
R2010:Myh8 UTSW 11 67297164 nonsense probably null
R2095:Myh8 UTSW 11 67286224 missense probably benign 0.00
R2132:Myh8 UTSW 11 67292876 missense probably damaging 1.00
R2152:Myh8 UTSW 11 67294469 missense probably damaging 0.97
R2229:Myh8 UTSW 11 67308348 missense probably damaging 0.98
R2302:Myh8 UTSW 11 67286239 missense probably damaging 1.00
R2364:Myh8 UTSW 11 67294518 missense probably benign 0.03
R2429:Myh8 UTSW 11 67303897 missense probably benign 0.21
R2880:Myh8 UTSW 11 67297264 missense probably damaging 0.97
R3692:Myh8 UTSW 11 67301918 missense probably damaging 0.98
R3756:Myh8 UTSW 11 67284617 unclassified probably benign
R3924:Myh8 UTSW 11 67297137 missense probably damaging 0.99
R4172:Myh8 UTSW 11 67292421 missense probably damaging 1.00
R4255:Myh8 UTSW 11 67299734 missense probably benign
R4621:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4623:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4790:Myh8 UTSW 11 67279963 missense probably damaging 0.99
R4914:Myh8 UTSW 11 67292684 missense probably damaging 1.00
R5074:Myh8 UTSW 11 67305916 missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67298358 missense probably damaging 1.00
R5159:Myh8 UTSW 11 67288353 missense probably damaging 0.99
R5229:Myh8 UTSW 11 67284484 missense probably damaging 0.96
R5320:Myh8 UTSW 11 67286263 missense probably damaging 1.00
R5455:Myh8 UTSW 11 67301418 missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67305962 missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67286440 missense probably benign 0.00
R5726:Myh8 UTSW 11 67294566 missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67297200 missense probably damaging 1.00
R6135:Myh8 UTSW 11 67297500 missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67301967 missense probably benign 0.06
R6318:Myh8 UTSW 11 67299341 missense probably benign 0.00
R6432:Myh8 UTSW 11 67298579 missense probably benign 0.01
R6452:Myh8 UTSW 11 67292449 missense probably benign 0.27
R6452:Myh8 UTSW 11 67305739 missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67289662 nonsense probably null
R6714:Myh8 UTSW 11 67306949 missense probably damaging 1.00
R6842:Myh8 UTSW 11 67284655 missense probably damaging 1.00
R7007:Myh8 UTSW 11 67288316 missense probably benign 0.03
R7025:Myh8 UTSW 11 67297539 missense probably benign 0.02
R7086:Myh8 UTSW 11 67292627 splice site probably null
R7098:Myh8 UTSW 11 67279053 missense probably benign 0.03
R7498:Myh8 UTSW 11 67283437 missense possibly damaging 0.80
T0722:Myh8 UTSW 11 67304436 missense probably benign 0.41
Z1088:Myh8 UTSW 11 67298592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCAGTCCTCTTTGCCGAATAGC -3'
(R):5'- TTTCTTCCAGGAGACCCAGGAGAC -3'

Sequencing Primer
(F):5'- TTGTTCTGGGAGTTAAACAACTAC -3'
(R):5'- ACCCAGGAGACCAGCTTTG -3'
Posted On2014-03-28