Incidental Mutation 'R1611:Acsl6'
ID176809
Institutional Source Beutler Lab
Gene Symbol Acsl6
Ensembl Gene ENSMUSG00000020333
Gene Nameacyl-CoA synthetase long-chain family member 6
SynonymsLacsl, Facl6, A330035H04Rik
MMRRC Submission 039648-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R1611 (G1)
Quality Score221
Status Validated
Chromosome11
Chromosomal Location54303798-54364756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54325564 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 186 (I186F)
Ref Sequence ENSEMBL: ENSMUSP00000104533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000145] [ENSMUST00000064690] [ENSMUST00000072178] [ENSMUST00000093106] [ENSMUST00000094194] [ENSMUST00000101211] [ENSMUST00000101213] [ENSMUST00000108899] [ENSMUST00000108904] [ENSMUST00000108905] [ENSMUST00000138515] [ENSMUST00000149403] [ENSMUST00000156252]
Predicted Effect probably benign
Transcript: ENSMUST00000000145
AA Change: I126F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000000145
Gene: ENSMUSG00000020333
AA Change: I126F

DomainStartEndE-ValueType
Pfam:AMP-binding 68 273 7.7e-39 PFAM
Pfam:AMP-binding 262 488 2.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064690
AA Change: I161F

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000069844
Gene: ENSMUSG00000020333
AA Change: I161F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 102 346 5.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072178
AA Change: I161F

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000072040
Gene: ENSMUSG00000020333
AA Change: I161F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093106
AA Change: I161F

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000090795
Gene: ENSMUSG00000020333
AA Change: I161F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094194
AA Change: I161F

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000091746
Gene: ENSMUSG00000020333
AA Change: I161F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 2.3e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101211
AA Change: I161F

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000098771
Gene: ENSMUSG00000020333
AA Change: I161F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101213
AA Change: I161F

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000098773
Gene: ENSMUSG00000020333
AA Change: I161F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 563 1.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108899
AA Change: I161F

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104527
Gene: ENSMUSG00000020333
AA Change: I161F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 103 409 2.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108904
AA Change: I186F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104532
Gene: ENSMUSG00000020333
AA Change: I186F

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 1.6e-103 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108905
AA Change: I186F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104533
Gene: ENSMUSG00000020333
AA Change: I186F

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
Pfam:AMP-binding 128 588 7.7e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138515
AA Change: I161F

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117128
Gene: ENSMUSG00000020333
AA Change: I161F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 101 192 5.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149403
SMART Domains Protein: ENSMUSP00000120540
Gene: ENSMUSG00000020333

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SCOP:d1lci__ 82 139 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156252
AA Change: I126F

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119714
Gene: ENSMUSG00000020333
AA Change: I126F

DomainStartEndE-ValueType
Pfam:AMP-binding 67 363 4.9e-54 PFAM
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of acyl-CoA from fatty acids, ATP, and CoA, using magnesium as a cofactor. The encoded protein plays a major role in fatty acid metabolism in the brain. Translocations with the ETV6 gene are causes of myelodysplastic syndrome with basophilia, acute myelogenous leukemia with eosinophilia, and acute eosinophilic leukemia. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G A 1: 136,216,117 P527L probably damaging Het
Actr6 T A 10: 89,732,202 K14* probably null Het
Adgrv1 A T 13: 81,559,117 V1390E probably damaging Het
Akap1 C T 11: 88,845,278 R186K probably benign Het
Alg10b T A 15: 90,225,781 V99D probably damaging Het
Atp2c1 C T 9: 105,442,852 G407S probably damaging Het
Atp9a T C 2: 168,673,569 M401V probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bclaf1 T C 10: 20,323,252 probably benign Het
Bcr T A 10: 75,125,202 probably null Het
Bivm T C 1: 44,126,747 I119T possibly damaging Het
Cacna1h A G 17: 25,381,471 I1632T probably damaging Het
Capn9 G A 8: 124,611,512 V537M possibly damaging Het
Cdk11b G A 4: 155,641,575 probably benign Het
Cdk18 T A 1: 132,122,375 I21F probably damaging Het
Cep85l T C 10: 53,348,681 T271A probably benign Het
Chrm5 T C 2: 112,479,187 N528S possibly damaging Het
Cpsf6 T A 10: 117,361,828 probably benign Het
Cpt1c T C 7: 44,960,112 T689A probably benign Het
D030068K23Rik T C 8: 109,249,303 Y64C unknown Het
Ddb1 T A 19: 10,612,888 C260S probably damaging Het
Ddb1 T A 19: 10,626,764 probably null Het
Ddx58 T C 4: 40,223,862 Y339C probably damaging Het
Depdc5 C A 5: 32,990,953 Q1478K probably damaging Het
Diaph1 A C 18: 37,900,702 M247R unknown Het
Dusp8 T C 7: 142,082,957 S299G probably benign Het
Erbb4 C A 1: 68,040,388 G1178C probably damaging Het
Exoc7 A T 11: 116,295,265 I370N possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 Y27* probably null Het
Gnl1 C T 17: 35,987,549 T395I probably damaging Het
Hpse2 G A 19: 42,789,065 T554I probably damaging Het
Hsd17b11 T C 5: 104,009,899 I116V probably benign Het
Kif24 A T 4: 41,423,552 V233E probably benign Het
Klhl5 A G 5: 65,164,649 T673A probably benign Het
Kmt2c C A 5: 25,359,311 probably null Het
Lipg T C 18: 74,948,059 N317S possibly damaging Het
Lpin1 A T 12: 16,577,218 L109Q probably null Het
Lyst A G 13: 13,634,897 E384G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Muc4 C T 16: 32,750,986 T288I possibly damaging Het
Naa35 G T 13: 59,628,933 R574L probably benign Het
Ncor2 T C 5: 125,110,020 probably benign Het
Nedd9 T A 13: 41,316,930 D249V probably benign Het
Nsg1 T A 5: 38,138,716 K38* probably null Het
Nup155 T A 15: 8,130,160 D518E probably damaging Het
Olfr152 T A 2: 87,782,624 I28N probably benign Het
Ovol1 T A 19: 5,551,070 H231L probably damaging Het
Parg A G 14: 32,238,570 I586V probably damaging Het
Pde7b T C 10: 20,434,490 N242S probably benign Het
Pias3 T A 3: 96,699,697 probably null Het
Pramef12 A T 4: 144,392,812 V395E probably benign Het
Ptprf A G 4: 118,236,233 V404A probably benign Het
Rnf145 T C 11: 44,551,798 L259P probably damaging Het
Rps6ka5 C G 12: 100,570,852 V540L possibly damaging Het
Ryr3 C T 2: 112,653,505 D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 S1163R probably benign Het
Serpinb9g T C 13: 33,492,874 I213T possibly damaging Het
Sil1 A T 18: 35,269,088 V331E possibly damaging Het
Ski A G 4: 155,159,938 F410S probably damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Slfnl1 A G 4: 120,533,377 E75G probably benign Het
Sp1 T A 15: 102,430,935 I436N probably damaging Het
Taf4b A T 18: 14,844,469 E766V probably null Het
Tgfbr1 A G 4: 47,396,526 Y180C probably damaging Het
Ube4a T C 9: 44,956,737 probably benign Het
Vmn2r1 T A 3: 64,104,537 C606* probably null Het
Wdr63 T C 3: 146,095,358 Y115C probably damaging Het
Zfp341 C A 2: 154,645,703 H702Q probably damaging Het
Other mutations in Acsl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Acsl6 APN 11 54325646 missense probably damaging 1.00
IGL01374:Acsl6 APN 11 54338419 missense probably damaging 1.00
IGL01455:Acsl6 APN 11 54323305 missense possibly damaging 0.93
IGL01607:Acsl6 APN 11 54352997 missense possibly damaging 0.94
IGL01731:Acsl6 APN 11 54350559 missense probably benign 0.04
IGL01775:Acsl6 APN 11 54346000 splice site probably benign
IGL02487:Acsl6 APN 11 54336943 missense possibly damaging 0.76
IGL02716:Acsl6 APN 11 54327276 missense probably benign 0.02
IGL02893:Acsl6 APN 11 54345899 missense probably damaging 1.00
R0514:Acsl6 UTSW 11 54350580 missense probably damaging 1.00
R0739:Acsl6 UTSW 11 54337135 missense probably damaging 1.00
R1593:Acsl6 UTSW 11 54323308 missense probably damaging 1.00
R1626:Acsl6 UTSW 11 54352046 missense probably damaging 1.00
R1633:Acsl6 UTSW 11 54328398 splice site probably benign
R1697:Acsl6 UTSW 11 54329966 missense probably damaging 1.00
R1852:Acsl6 UTSW 11 54361076 missense probably damaging 1.00
R1923:Acsl6 UTSW 11 54325591 missense probably damaging 1.00
R2081:Acsl6 UTSW 11 54320259 missense possibly damaging 0.76
R2144:Acsl6 UTSW 11 54341778 missense probably damaging 1.00
R2167:Acsl6 UTSW 11 54327157 missense probably benign 0.03
R2205:Acsl6 UTSW 11 54324007 missense probably damaging 1.00
R2357:Acsl6 UTSW 11 54327280 missense probably damaging 0.99
R4288:Acsl6 UTSW 11 54337086 missense probably benign 0.19
R4450:Acsl6 UTSW 11 54328403 missense probably damaging 1.00
R4783:Acsl6 UTSW 11 54336993 missense probably damaging 1.00
R5115:Acsl6 UTSW 11 54340498 unclassified probably null
R5233:Acsl6 UTSW 11 54325606 missense possibly damaging 0.69
R5416:Acsl6 UTSW 11 54337171 missense probably benign 0.00
R5482:Acsl6 UTSW 11 54327138 missense probably damaging 1.00
R5633:Acsl6 UTSW 11 54337189 missense probably benign
R5749:Acsl6 UTSW 11 54324055 critical splice donor site probably null
R6139:Acsl6 UTSW 11 54340542 missense probably damaging 1.00
R6270:Acsl6 UTSW 11 54352107 missense probably benign 0.45
R6337:Acsl6 UTSW 11 54340542 missense probably damaging 1.00
R6571:Acsl6 UTSW 11 54325564 missense possibly damaging 0.85
R6736:Acsl6 UTSW 11 54325166 missense probably damaging 1.00
R6918:Acsl6 UTSW 11 54341756 splice site probably null
R6919:Acsl6 UTSW 11 54341756 splice site probably null
Predicted Primers PCR Primer
(F):5'- CATTGTACCTGGAGTCGCAAAGGAG -3'
(R):5'- CAAGTCAGGGGCCATCGTATAAGC -3'

Sequencing Primer
(F):5'- TCGCAAAGGAGGAAGAGTC -3'
(R):5'- gatagtctcacacagcccag -3'
Posted On2014-04-24