Incidental Mutation 'R1837:Col2a1'
ID205438
Institutional Source Beutler Lab
Gene Symbol Col2a1
Ensembl Gene ENSMUSG00000022483
Gene Namecollagen, type II, alpha 1
SynonymsM100856, Col2a, Col2a-1, Del1, Col2, Rgsc856, Lpk
MMRRC Submission 039864-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1837 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location97975602-98004695 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 97996641 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023123] [ENSMUST00000088355] [ENSMUST00000131560]
Predicted Effect probably benign
Transcript: ENSMUST00000023123
SMART Domains Protein: ENSMUSP00000023123
Gene: ENSMUSG00000022483

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
Pfam:Collagen 115 175 1.3e-11 PFAM
Pfam:Collagen 199 260 7.2e-11 PFAM
Pfam:Collagen 258 317 1.3e-12 PFAM
Pfam:Collagen 312 377 4e-9 PFAM
low complexity region 395 411 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
internal_repeat_5 456 468 5.45e-5 PROSPERO
low complexity region 471 513 N/A INTRINSIC
internal_repeat_3 516 619 3.99e-13 PROSPERO
internal_repeat_1 524 567 1.6e-17 PROSPERO
low complexity region 621 633 N/A INTRINSIC
low complexity region 636 655 N/A INTRINSIC
low complexity region 659 687 N/A INTRINSIC
low complexity region 696 753 N/A INTRINSIC
internal_repeat_5 756 768 5.45e-5 PROSPERO
low complexity region 783 804 N/A INTRINSIC
Pfam:Collagen 852 918 1.1e-8 PFAM
Pfam:Collagen 876 941 1.9e-9 PFAM
Pfam:Collagen 900 966 2.4e-9 PFAM
Pfam:Collagen 983 1049 2.1e-10 PFAM
low complexity region 1062 1081 N/A INTRINSIC
Pfam:Collagen 1101 1172 3.4e-9 PFAM
Pfam:Collagen 1158 1218 1.3e-9 PFAM
COLFI 1252 1487 3.06e-184 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088355
SMART Domains Protein: ENSMUSP00000085693
Gene: ENSMUSG00000022483

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Collagen 47 107 1.2e-11 PFAM
Pfam:Collagen 131 192 7.2e-11 PFAM
Pfam:Collagen 190 249 1.3e-12 PFAM
low complexity region 262 314 N/A INTRINSIC
Pfam:Collagen 327 405 3.5e-7 PFAM
Pfam:Collagen 361 429 7.6e-10 PFAM
internal_repeat_3 448 551 1.3e-13 PROSPERO
internal_repeat_7 454 466 2.86e-5 PROSPERO
internal_repeat_1 456 499 4.05e-18 PROSPERO
internal_repeat_6 481 504 1.7e-5 PROSPERO
low complexity region 553 565 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
low complexity region 591 619 N/A INTRINSIC
low complexity region 628 685 N/A INTRINSIC
internal_repeat_4 688 712 8.3e-12 PROSPERO
low complexity region 715 736 N/A INTRINSIC
low complexity region 747 784 N/A INTRINSIC
Pfam:Collagen 808 878 9.8e-9 PFAM
Pfam:Collagen 832 898 2.1e-9 PFAM
Pfam:Collagen 916 979 7.2e-10 PFAM
Pfam:Collagen 937 1005 2.1e-8 PFAM
Pfam:Collagen 973 1049 6e-7 PFAM
Pfam:Collagen 1030 1094 1.5e-10 PFAM
Pfam:Collagen 1088 1150 1.4e-9 PFAM
COLFI 1184 1419 3.06e-184 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131560
SMART Domains Protein: ENSMUSP00000116951
Gene: ENSMUSG00000022483

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
low complexity region 109 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230148
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type II collagen, the major component of cartilage and the vitreous humor of the eye. The encoded preproprotein forms homotrimeric, triple helical procollagen that undergoes proteolytic processing during fibirl formation. Mice harboring certain mutations in this gene exhibit severe chondrodysplasia characterized by short limbs and trunch, craniofacial deformities and cleft palate. A complete lack of the encoded protein in mice results in postnatal lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this locus affect cartilage development. Homozygotes die perinatally with anomalies such as shortened limbs without epiphiseal growth plates, cleft palate and persistence of notochord. Heterozygotes are dwarfed with reduced cartilage matrix. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 G T 2: 154,553,042 G305W probably damaging Het
Actr3b A T 5: 25,825,159 T74S probably benign Het
Add2 A G 6: 86,118,558 E652G probably damaging Het
Alg9 T A 9: 50,806,315 V83D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Bcr A G 10: 75,168,100 probably benign Het
Begain G A 12: 109,035,323 probably benign Het
Bzw1 A G 1: 58,400,118 K67E probably damaging Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Cdc73 T A 1: 143,667,657 T314S possibly damaging Het
Cfap206 T C 4: 34,728,813 T31A probably damaging Het
Cfap58 G A 19: 48,029,139 E813K probably damaging Het
Clstn2 C A 9: 97,583,540 A133S probably benign Het
Col14a1 A T 15: 55,382,495 D465V unknown Het
Dab2 A G 15: 6,336,476 probably benign Het
Eme1 T C 11: 94,645,961 D464G probably benign Het
Eml6 T C 11: 29,749,802 probably null Het
Ern1 C A 11: 106,458,957 L44F probably damaging Het
Fam111a T A 19: 12,587,452 S188R probably benign Het
Fam151b A T 13: 92,474,131 probably benign Het
Fmo6 T C 1: 162,922,810 N226D probably benign Het
Ggt1 A G 10: 75,579,294 D214G probably benign Het
Gm14226 A G 2: 155,025,010 I296V probably benign Het
Gm9915 A T 1: 42,230,687 noncoding transcript Het
Heatr5b T C 17: 78,820,751 D485G possibly damaging Het
Helz2 A T 2: 181,229,289 I2785N probably damaging Het
Htt C T 5: 34,819,023 T723M probably benign Het
Hydin C A 8: 110,569,625 H3595Q probably benign Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krt7 A G 15: 101,419,582 D252G probably benign Het
Lad1 C A 1: 135,829,706 D394E probably benign Het
Lhx8 A T 3: 154,328,055 C38S possibly damaging Het
Lta4h C T 10: 93,469,175 T280M probably damaging Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Med1 G T 11: 98,169,412 D230E probably damaging Het
Mmp1b A T 9: 7,386,409 F171I probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mtrf1 A G 14: 79,401,833 E135G possibly damaging Het
Muc5ac T A 7: 141,807,086 M1378K probably benign Het
Myo3a A T 2: 22,577,592 Q286L possibly damaging Het
Ndor1 C T 2: 25,248,396 G391R probably damaging Het
Nefl C T 14: 68,086,626 R438C probably damaging Het
Nlrp3 G A 11: 59,548,916 V440I probably benign Het
Notch3 A T 17: 32,124,322 L1959Q probably damaging Het
Noto A G 6: 85,424,177 T63A probably benign Het
Oc90 G A 15: 65,889,680 T163M probably damaging Het
Olfr1219 A T 2: 89,074,832 Y86* probably null Het
Olfr1436 A G 19: 12,298,376 V252A probably damaging Het
Olfr365 T A 2: 37,202,102 M287K probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Phlda1 A G 10: 111,507,231 Q276R probably benign Het
Ptpn21 T G 12: 98,733,626 K10Q probably damaging Het
Ptprb A G 10: 116,341,626 E1364G probably benign Het
Rabep1 T A 11: 70,904,658 W237R probably damaging Het
Rai1 A T 11: 60,189,398 K1429N probably damaging Het
Rapgef1 A G 2: 29,737,426 I1027M probably damaging Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Rpap1 A C 2: 119,769,885 probably null Het
Senp7 T A 16: 56,158,516 C471S probably benign Het
Slc16a14 A G 1: 84,912,399 V395A probably benign Het
Slc45a1 C T 4: 150,638,459 G323S probably benign Het
Syne2 A T 12: 75,967,660 E3208D probably damaging Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Ticam1 T C 17: 56,270,799 E432G possibly damaging Het
Tmem192 C A 8: 64,964,340 probably benign Het
Trub1 T C 19: 57,453,029 V28A probably benign Het
Ttc21b A T 2: 66,197,762 L1121H probably benign Het
Ttc38 A G 15: 85,851,563 D290G probably damaging Het
Ulk1 C T 5: 110,789,381 G683D probably damaging Het
Vmn1r122 A T 7: 21,133,366 F255I probably benign Het
Vmn2r68 T A 7: 85,233,678 I289F probably damaging Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Wdr48 T G 9: 119,905,416 S134A probably damaging Het
Yap1 A T 9: 7,962,349 Y139N probably damaging Het
Ylpm1 T C 12: 85,029,333 V486A possibly damaging Het
Zbtb38 T C 9: 96,686,995 T679A probably benign Het
Zfp292 A G 4: 34,810,264 S927P probably damaging Het
Zfp324 C T 7: 12,970,229 T115I probably benign Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp945 A T 17: 22,851,273 C551S probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Col2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Col2a1 APN 15 97976173 missense unknown
IGL01286:Col2a1 APN 15 97994878 missense unknown
IGL01369:Col2a1 APN 15 97977826 missense unknown
IGL01747:Col2a1 APN 15 97991392 splice site probably benign
IGL02086:Col2a1 APN 15 97986737 splice site probably null
IGL02549:Col2a1 APN 15 97977799 missense unknown
IGL03289:Col2a1 APN 15 97980881 missense unknown
IGL03369:Col2a1 APN 15 97982042 missense unknown
FR4304:Col2a1 UTSW 15 97988981 synonymous probably null
FR4340:Col2a1 UTSW 15 97988981 synonymous probably null
FR4342:Col2a1 UTSW 15 97988981 synonymous probably null
FR4589:Col2a1 UTSW 15 97988981 synonymous probably null
LCD18:Col2a1 UTSW 15 97988981 synonymous probably null
R0124:Col2a1 UTSW 15 97998862 missense unknown
R0227:Col2a1 UTSW 15 97976755 missense unknown
R0690:Col2a1 UTSW 15 97980192 missense unknown
R1434:Col2a1 UTSW 15 97979651 missense probably damaging 0.96
R1473:Col2a1 UTSW 15 97982908 splice site probably benign
R1577:Col2a1 UTSW 15 97979202 missense probably damaging 1.00
R1598:Col2a1 UTSW 15 97979250 missense probably damaging 0.99
R2153:Col2a1 UTSW 15 97987580 missense unknown
R2965:Col2a1 UTSW 15 97976095 missense unknown
R2966:Col2a1 UTSW 15 97976095 missense unknown
R3710:Col2a1 UTSW 15 97990907 splice site probably benign
R3838:Col2a1 UTSW 15 97988976 missense unknown
R3838:Col2a1 UTSW 15 98000581 intron probably benign
R4112:Col2a1 UTSW 15 97983701 missense probably benign 0.18
R4417:Col2a1 UTSW 15 97998585 missense unknown
R4656:Col2a1 UTSW 15 97976176 missense unknown
R4960:Col2a1 UTSW 15 97976149 missense unknown
R5008:Col2a1 UTSW 15 97979669 missense probably benign 0.28
R5435:Col2a1 UTSW 15 98000510 intron probably benign
R5473:Col2a1 UTSW 15 97987489 missense unknown
R6042:Col2a1 UTSW 15 98000570 intron probably benign
R6118:Col2a1 UTSW 15 97998567 missense unknown
R6183:Col2a1 UTSW 15 97988790 missense unknown
R6187:Col2a1 UTSW 15 97988790 missense unknown
R6401:Col2a1 UTSW 15 97985892 missense unknown
R6550:Col2a1 UTSW 15 97976793 missense unknown
R6568:Col2a1 UTSW 15 97977276 missense unknown
R6988:Col2a1 UTSW 15 98004454 missense unknown
R7060:Col2a1 UTSW 15 97976141 missense unknown
R7069:Col2a1 UTSW 15 97998588 missense unknown
R7167:Col2a1 UTSW 15 98000456 missense unknown
R7392:Col2a1 UTSW 15 97980151 nonsense probably null
R7491:Col2a1 UTSW 15 97976159 missense not run
Predicted Primers PCR Primer
(F):5'- AAGATTGTCCCCAGAGCCTC -3'
(R):5'- AGTAAACATGGCCGCCATCC -3'

Sequencing Primer
(F):5'- AGCCTCCTGGGAGAGGGTAG -3'
(R):5'- AGCGTCTCGGTCCAAATG -3'
Posted On2014-06-23