Incidental Mutation 'R1830:Chordc1'
ID207238
Institutional Source Beutler Lab
Gene Symbol Chordc1
Ensembl Gene ENSMUSG00000001774
Gene Namecysteine and histidine-rich domain (CHORD)-containing, zinc-binding protein 1
SynonymsChp-1, 1110001O09Rik, morgana
MMRRC Submission 039857-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1830 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location18292125-18317442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18311978 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 245 (Y245H)
Ref Sequence ENSEMBL: ENSMUSP00000150569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001825] [ENSMUST00000216800] [ENSMUST00000217031] [ENSMUST00000217083]
Predicted Effect probably damaging
Transcript: ENSMUST00000001825
AA Change: Y246H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001825
Gene: ENSMUSG00000001774
AA Change: Y246H

DomainStartEndE-ValueType
Pfam:CHORD 3 64 3.4e-32 PFAM
low complexity region 67 89 N/A INTRINSIC
low complexity region 132 154 N/A INTRINSIC
Pfam:CHORD 155 216 4.5e-29 PFAM
Pfam:CS 230 306 4.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216666
Predicted Effect probably benign
Transcript: ENSMUST00000216800
Predicted Effect probably damaging
Transcript: ENSMUST00000217031
AA Change: Y245H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000217083
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before somite formation with decreased proliferation and increased apoptosis of cultured inner cell masse cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,946,717 D532G possibly damaging Het
Abca13 T C 11: 9,290,350 S738P probably benign Het
Abi3bp C A 16: 56,587,985 P261Q probably damaging Het
Adam19 A G 11: 46,127,278 N389S probably damaging Het
Adgrv1 A T 13: 81,489,077 V3415D possibly damaging Het
Ankrd33 A T 15: 101,119,551 I282F probably damaging Het
Arhgap39 C T 15: 76,735,183 V734M probably damaging Het
Arsg T C 11: 109,563,274 probably null Het
Atp8b4 C T 2: 126,403,381 G283R probably benign Het
B3galnt2 T G 13: 13,991,534 L338* probably null Het
C87414 A T 5: 93,637,686 I245K probably benign Het
Cdc14a A T 3: 116,422,647 Y1* probably null Het
Ceacam16 T C 7: 19,858,878 E35G possibly damaging Het
Cfap46 T A 7: 139,640,407 D1244V possibly damaging Het
Col6a6 C A 9: 105,702,270 V1919F probably damaging Het
Colgalt1 T C 8: 71,623,137 V476A probably damaging Het
Cped1 T C 6: 22,237,728 C948R probably damaging Het
Cyfip2 T C 11: 46,199,019 D1189G probably damaging Het
Cyp27b1 T C 10: 127,049,083 Y72H possibly damaging Het
Dagla A G 19: 10,271,014 M94T probably benign Het
Dip2a A G 10: 76,317,963 S178P probably damaging Het
Dlec1 T C 9: 119,138,790 V1220A probably benign Het
Dpysl2 T C 14: 66,868,391 probably benign Het
E2f6 T C 12: 16,818,883 V69A probably benign Het
Fat3 T C 9: 15,915,340 T4439A probably benign Het
Fn1 T C 1: 71,624,259 I1023M probably damaging Het
Gabrr2 G A 4: 33,077,481 V83M probably damaging Het
Gfral T C 9: 76,193,203 N318D probably benign Het
Gm5611 A T 9: 17,030,777 noncoding transcript Het
Gpat3 A T 5: 100,893,180 M369L probably benign Het
Grik5 T C 7: 25,046,301 D449G possibly damaging Het
Gucy2g T A 19: 55,222,930 T623S possibly damaging Het
H2-T22 T C 17: 36,041,542 T164A probably benign Het
Herc1 T A 9: 66,497,599 C4484S possibly damaging Het
Hira T C 16: 18,947,414 S659P probably damaging Het
Hoxa7 T C 6: 52,217,327 T27A possibly damaging Het
Hoxd1 T C 2: 74,763,522 S141P probably damaging Het
Kank1 C A 19: 25,411,032 Q690K probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif1bp T C 10: 62,559,327 Y512C probably damaging Het
Lepr A C 4: 101,735,677 Y163S probably damaging Het
Leprotl1 T C 8: 34,140,768 I29V probably benign Het
Lrriq1 T G 10: 103,161,759 T1332P probably benign Het
Mrps15 A G 4: 126,055,407 K223E probably damaging Het
Mrps7 T A 11: 115,606,985 N225K probably benign Het
Nav3 T A 10: 109,823,323 D811V probably damaging Het
Ndst3 T A 3: 123,548,938 R741S probably damaging Het
Nos3 T C 5: 24,370,133 Y356H probably damaging Het
Nxpe3 A G 16: 55,866,081 V188A probably damaging Het
Olfr1057 T C 2: 86,375,143 K90E possibly damaging Het
Olfr469 T A 7: 107,823,371 I33F probably benign Het
Olfr702 T C 7: 106,824,110 R139G probably benign Het
Pdia4 A T 6: 47,796,761 C551* probably null Het
Pex13 A G 11: 23,655,513 F239S probably damaging Het
Pigq A G 17: 25,935,006 M273T probably benign Het
Plppr2 C T 9: 21,947,751 P388L probably damaging Het
Polr3b C T 10: 84,692,922 Q737* probably null Het
Ppfibp1 T C 6: 147,022,259 probably null Het
Ppfibp2 C A 7: 107,637,297 D17E probably damaging Het
Ptpn13 A G 5: 103,543,459 D1064G probably benign Het
Qtrt2 A T 16: 43,871,655 S168T probably damaging Het
Rbp3 T C 14: 33,954,644 V183A probably benign Het
Shprh T C 10: 11,186,911 probably null Het
Slc39a10 T C 1: 46,836,070 H24R probably damaging Het
Slc7a13 A T 4: 19,819,046 H82L probably benign Het
Sptbn2 A G 19: 4,732,541 I502V probably benign Het
Syne2 C T 12: 76,109,862 R6811C probably damaging Het
Syt12 A G 19: 4,456,883 V78A probably benign Het
Tbck T A 3: 132,838,011 D874E probably benign Het
Tesc A T 5: 118,046,329 I25L probably damaging Het
Thoc5 T G 11: 4,914,608 D351E probably benign Het
Tor1aip1 A T 1: 156,007,562 M180K probably damaging Het
Trps1 T C 15: 50,661,136 S842G probably damaging Het
Unc79 A T 12: 103,134,478 T1858S probably damaging Het
Vmn1r193 T C 13: 22,219,391 T144A probably benign Het
Vwa8 T C 14: 79,081,136 F1046S probably benign Het
Wdr26 A T 1: 181,191,775 W346R probably damaging Het
Zfp740 T A 15: 102,207,901 V22E probably damaging Het
Zw10 C A 9: 49,069,741 S480R probably damaging Het
Other mutations in Chordc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Chordc1 APN 9 18302092 missense possibly damaging 0.84
IGL03155:Chordc1 APN 9 18304320 missense possibly damaging 0.88
IGL03343:Chordc1 APN 9 18312466 missense probably damaging 0.98
garner UTSW 9 18295332 missense probably damaging 1.00
R2299:Chordc1 UTSW 9 18302108 missense probably damaging 0.99
R4797:Chordc1 UTSW 9 18292376 unclassified probably benign
R4808:Chordc1 UTSW 9 18292413 missense probably damaging 1.00
R5086:Chordc1 UTSW 9 18312835 missense probably benign 0.00
R5667:Chordc1 UTSW 9 18295332 missense probably damaging 1.00
R5929:Chordc1 UTSW 9 18304362 missense possibly damaging 0.86
R7212:Chordc1 UTSW 9 18295351 critical splice donor site probably null
R7212:Chordc1 UTSW 9 18301012 missense probably damaging 1.00
R7605:Chordc1 UTSW 9 18304372 missense probably benign 0.01
R7726:Chordc1 UTSW 9 18302214 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGCCCTGAATGCATGAAGTG -3'
(R):5'- TGAGCCCCACTGTTTCATTTAAG -3'

Sequencing Primer
(F):5'- CACATTAACTGACCCAGTTC -3'
(R):5'- TAGCTAGAAGATTGATACTGAGACAC -3'
Posted On2014-06-23