Incidental Mutation 'R1830:Gabrr2'
ID207211
Institutional Source Beutler Lab
Gene Symbol Gabrr2
Ensembl Gene ENSMUSG00000023267
Gene Namegamma-aminobutyric acid (GABA) C receptor, subunit rho 2
Synonyms
MMRRC Submission 039857-MU
Accession Numbers

Genbank: NM_008076; MGI: 95626; Ensembl: ENSMUST00000108162, ENSMUST00000147889, ENSMUST00000131920, ENSMUST00000024035

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1830 (G1)
Quality Score184
Status Not validated
Chromosome4
Chromosomal Location33062999-33095865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33077481 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 83 (V83M)
Ref Sequence ENSEMBL: ENSMUSP00000103797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024035] [ENSMUST00000108162] [ENSMUST00000131920]
Predicted Effect probably damaging
Transcript: ENSMUST00000024035
AA Change: V108M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024035
Gene: ENSMUSG00000023267
AA Change: V108M

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 81 286 3.4e-53 PFAM
Pfam:Neur_chan_memb 293 454 1.9e-32 PFAM
transmembrane domain 472 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108162
AA Change: V83M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103797
Gene: ENSMUSG00000023267
AA Change: V83M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 57 261 9.7e-57 PFAM
Pfam:Neur_chan_memb 268 414 4.2e-36 PFAM
transmembrane domain 447 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131920
SMART Domains Protein: ENSMUSP00000118514
Gene: ENSMUSG00000023267

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 1 162 3.3e-46 PFAM
Pfam:Neur_chan_memb 169 204 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147889
SMART Domains Protein: ENSMUSP00000114337
Gene: ENSMUSG00000023267

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 1 107 7.1e-28 PFAM
Pfam:Neur_chan_memb 114 219 1.1e-33 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. The protein encoded by this gene is a member of the rho subunit family and is a component of the GABA type A receptor complex. This gene exists on chromosome 6q next to the gene encoding the rho 1 subunit of the GABA type A receptor, in a region thought to be associated with susceptibility for psychiatric disorders and epilepsy. Polymorphisms in this gene may also be associated with alcohol dependence, and general cognitive ability. [provided by RefSeq, Apr 2016]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik T C 17: 25,946,717 D532G possibly damaging Het
Abca13 T C 11: 9,290,350 S738P probably benign Het
Abi3bp C A 16: 56,587,985 P261Q probably damaging Het
Adam19 A G 11: 46,127,278 N389S probably damaging Het
Adgrv1 A T 13: 81,489,077 V3415D possibly damaging Het
Ankrd33 A T 15: 101,119,551 I282F probably damaging Het
Arhgap39 C T 15: 76,735,183 V734M probably damaging Het
Arsg T C 11: 109,563,274 probably null Het
Atp8b4 C T 2: 126,403,381 G283R probably benign Het
B3galnt2 T G 13: 13,991,534 L338* probably null Het
C87414 A T 5: 93,637,686 I245K probably benign Het
Cdc14a A T 3: 116,422,647 Y1* probably null Het
Ceacam16 T C 7: 19,858,878 E35G possibly damaging Het
Cfap46 T A 7: 139,640,407 D1244V possibly damaging Het
Chordc1 T C 9: 18,311,978 Y245H probably damaging Het
Col6a6 C A 9: 105,702,270 V1919F probably damaging Het
Colgalt1 T C 8: 71,623,137 V476A probably damaging Het
Cped1 T C 6: 22,237,728 C948R probably damaging Het
Cyfip2 T C 11: 46,199,019 D1189G probably damaging Het
Cyp27b1 T C 10: 127,049,083 Y72H possibly damaging Het
Dagla A G 19: 10,271,014 M94T probably benign Het
Dip2a A G 10: 76,317,963 S178P probably damaging Het
Dlec1 T C 9: 119,138,790 V1220A probably benign Het
Dpysl2 T C 14: 66,868,391 probably benign Het
E2f6 T C 12: 16,818,883 V69A probably benign Het
Fat3 T C 9: 15,915,340 T4439A probably benign Het
Fn1 T C 1: 71,624,259 I1023M probably damaging Het
Gfral T C 9: 76,193,203 N318D probably benign Het
Gm5611 A T 9: 17,030,777 noncoding transcript Het
Gpat3 A T 5: 100,893,180 M369L probably benign Het
Grik5 T C 7: 25,046,301 D449G possibly damaging Het
Gucy2g T A 19: 55,222,930 T623S possibly damaging Het
H2-T22 T C 17: 36,041,542 T164A probably benign Het
Herc1 T A 9: 66,497,599 C4484S possibly damaging Het
Hira T C 16: 18,947,414 S659P probably damaging Het
Hoxa7 T C 6: 52,217,327 T27A possibly damaging Het
Hoxd1 T C 2: 74,763,522 S141P probably damaging Het
Kank1 C A 19: 25,411,032 Q690K probably benign Het
Kera A G 10: 97,609,147 K123E probably benign Het
Kif1bp T C 10: 62,559,327 Y512C probably damaging Het
Lepr A C 4: 101,735,677 Y163S probably damaging Het
Leprotl1 T C 8: 34,140,768 I29V probably benign Het
Lrriq1 T G 10: 103,161,759 T1332P probably benign Het
Mrps15 A G 4: 126,055,407 K223E probably damaging Het
Mrps7 T A 11: 115,606,985 N225K probably benign Het
Nav3 T A 10: 109,823,323 D811V probably damaging Het
Ndst3 T A 3: 123,548,938 R741S probably damaging Het
Nos3 T C 5: 24,370,133 Y356H probably damaging Het
Nxpe3 A G 16: 55,866,081 V188A probably damaging Het
Olfr1057 T C 2: 86,375,143 K90E possibly damaging Het
Olfr469 T A 7: 107,823,371 I33F probably benign Het
Olfr702 T C 7: 106,824,110 R139G probably benign Het
Pdia4 A T 6: 47,796,761 C551* probably null Het
Pex13 A G 11: 23,655,513 F239S probably damaging Het
Pigq A G 17: 25,935,006 M273T probably benign Het
Plppr2 C T 9: 21,947,751 P388L probably damaging Het
Polr3b C T 10: 84,692,922 Q737* probably null Het
Ppfibp1 T C 6: 147,022,259 probably null Het
Ppfibp2 C A 7: 107,637,297 D17E probably damaging Het
Ptpn13 A G 5: 103,543,459 D1064G probably benign Het
Qtrt2 A T 16: 43,871,655 S168T probably damaging Het
Rbp3 T C 14: 33,954,644 V183A probably benign Het
Shprh T C 10: 11,186,911 probably null Het
Slc39a10 T C 1: 46,836,070 H24R probably damaging Het
Slc7a13 A T 4: 19,819,046 H82L probably benign Het
Sptbn2 A G 19: 4,732,541 I502V probably benign Het
Syne2 C T 12: 76,109,862 R6811C probably damaging Het
Syt12 A G 19: 4,456,883 V78A probably benign Het
Tbck T A 3: 132,838,011 D874E probably benign Het
Tesc A T 5: 118,046,329 I25L probably damaging Het
Thoc5 T G 11: 4,914,608 D351E probably benign Het
Tor1aip1 A T 1: 156,007,562 M180K probably damaging Het
Trps1 T C 15: 50,661,136 S842G probably damaging Het
Unc79 A T 12: 103,134,478 T1858S probably damaging Het
Vmn1r193 T C 13: 22,219,391 T144A probably benign Het
Vwa8 T C 14: 79,081,136 F1046S probably benign Het
Wdr26 A T 1: 181,191,775 W346R probably damaging Het
Zfp740 T A 15: 102,207,901 V22E probably damaging Het
Zw10 C A 9: 49,069,741 S480R probably damaging Het
Other mutations in Gabrr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Gabrr2 APN 4 33085626 missense probably damaging 1.00
IGL02070:Gabrr2 APN 4 33095340 nonsense probably null
IGL03283:Gabrr2 APN 4 33082364 splice site probably benign
D3080:Gabrr2 UTSW 4 33084466 missense probably damaging 1.00
R1250:Gabrr2 UTSW 4 33063273 missense probably benign 0.20
R1381:Gabrr2 UTSW 4 33081420 missense probably damaging 1.00
R1630:Gabrr2 UTSW 4 33085647 missense probably damaging 1.00
R1782:Gabrr2 UTSW 4 33085593 missense probably damaging 1.00
R2000:Gabrr2 UTSW 4 33084400 missense probably damaging 1.00
R2125:Gabrr2 UTSW 4 33095548 missense probably damaging 1.00
R2679:Gabrr2 UTSW 4 33071435 missense probably damaging 1.00
R3695:Gabrr2 UTSW 4 33071430 missense probably damaging 1.00
R3891:Gabrr2 UTSW 4 33081348 missense probably damaging 1.00
R3892:Gabrr2 UTSW 4 33081348 missense probably damaging 1.00
R4902:Gabrr2 UTSW 4 33095512 missense probably damaging 1.00
R5328:Gabrr2 UTSW 4 33082565 missense probably damaging 1.00
R5330:Gabrr2 UTSW 4 33082583 missense possibly damaging 0.87
R5331:Gabrr2 UTSW 4 33082583 missense possibly damaging 0.87
R5399:Gabrr2 UTSW 4 33071458 critical splice donor site probably null
R7299:Gabrr2 UTSW 4 33095284 missense probably benign 0.02
R7301:Gabrr2 UTSW 4 33095284 missense probably benign 0.02
R7605:Gabrr2 UTSW 4 33082560 missense probably damaging 1.00
R7697:Gabrr2 UTSW 4 33071358 missense probably benign
R7860:Gabrr2 UTSW 4 33081470 nonsense probably null
R7943:Gabrr2 UTSW 4 33081470 nonsense probably null
X0017:Gabrr2 UTSW 4 33082328 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGTAGACCCAGTCTCTGAC -3'
(R):5'- TTGGGCCAACTTCCAAGACC -3'

Sequencing Primer
(F):5'- TCTCTGACCTCAGTGACAACGATG -3'
(R):5'- ACTTCCAAGACCCAATCTGG -3'
Posted On2014-06-23