Incidental Mutation 'R0127:Slc12a1'
ID21428
Institutional Source Beutler Lab
Gene Symbol Slc12a1
Ensembl Gene ENSMUSG00000027202
Gene Namesolute carrier family 12, member 1
Synonymsurehr3, mBSC1, Nkcc2, D630042G03Rik
MMRRC Submission 038412-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R0127 (G1)
Quality Score122
Status Validated (trace)
Chromosome2
Chromosomal Location125152505-125230002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125219762 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 958 (R958G)
Ref Sequence ENSEMBL: ENSMUSP00000106120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028630] [ENSMUST00000110494] [ENSMUST00000110495]
Predicted Effect probably damaging
Transcript: ENSMUST00000028630
AA Change: R958G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028630
Gene: ENSMUSG00000027202
AA Change: R958G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 82 152 5.3e-22 PFAM
Pfam:AA_permease 173 677 2.3e-152 PFAM
Pfam:AA_permease_2 177 636 2.6e-24 PFAM
coiled coil region 815 843 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110494
AA Change: R958G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106120
Gene: ENSMUSG00000027202
AA Change: R958G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 2.2e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110495
AA Change: R958G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106121
Gene: ENSMUSG00000027202
AA Change: R958G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AA_permease_N 83 148 3.3e-26 PFAM
Pfam:AA_permease 173 677 1.6e-151 PFAM
Pfam:SLC12 685 1090 1.5e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123574
Meta Mutation Damage Score 0.576 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kidney-specific sodium-potassium-chloride cotransporter that is expressed on the luminal membrane of renal epithelial cells of the thick ascending limb of Henle's loop and the macula densa. It plays a key role in concentrating urine and accounts for most of the NaCl resorption. It is sensitive to such diuretics as furosemide and bumetanide. Some Bartter-like syndromes result from defects in this gene. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity in humans has not been experimentally proven.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene do not survive to weaning and suffer from various metabolic abnormalities related to kidney function. Mice homozygous for an ENU-induced allele exhibit kidney disease, impaired urinary excretion of metabolism products, polyuria, and kidney alterations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,454 T152A probably benign Het
Abca1 T C 4: 53,067,155 I1351V probably benign Het
Acap1 A T 11: 69,887,217 probably benign Het
Als2cl T C 9: 110,891,867 L521P probably damaging Het
Ankrd50 T C 3: 38,456,235 D661G probably benign Het
Atp6v1b2 T A 8: 69,103,460 N262K probably damaging Het
Baz1a T A 12: 54,898,706 D1288V possibly damaging Het
Bbs1 A T 19: 4,895,029 D371E probably benign Het
Bphl A G 13: 34,064,046 probably benign Het
Caskin2 C A 11: 115,800,994 R988S probably damaging Het
Cbr1 C A 16: 93,609,987 T197N probably damaging Het
Ccdc88c T C 12: 100,935,740 E1213G possibly damaging Het
Ccna1 A G 3: 55,049,748 F83L probably damaging Het
Cep290 T A 10: 100,536,925 probably benign Het
Cep89 C A 7: 35,428,262 T543K possibly damaging Het
Cmtm7 T C 9: 114,781,670 M45V probably benign Het
Col16a1 T A 4: 130,052,857 V91E probably damaging Het
Csmd3 T C 15: 47,981,930 N920S probably benign Het
Cyp26b1 A G 6: 84,577,208 probably benign Het
Dao T A 5: 114,019,963 H215Q probably damaging Het
Dido1 T C 2: 180,671,824 D885G probably benign Het
Dlx4 T G 11: 95,141,229 M240L probably benign Het
Dnah5 C T 15: 28,294,925 P1351L probably damaging Het
Dnah6 T A 6: 73,038,734 probably benign Het
Dock5 A T 14: 67,846,042 D139E probably benign Het
Fam234b T C 6: 135,218,823 probably benign Het
Fat2 T C 11: 55,289,286 T1410A probably benign Het
Fsip2 T A 2: 82,984,925 N3667K probably benign Het
Gm14085 T A 2: 122,517,069 probably null Het
Gm5114 T C 7: 39,408,456 I580V probably benign Het
Hapln1 A T 13: 89,607,869 Y264F probably benign Het
Heatr5a A G 12: 51,925,405 V694A probably benign Het
Hps1 A G 19: 42,771,111 probably benign Het
Igsf9b G T 9: 27,334,385 R1216L possibly damaging Het
Il4ra G T 7: 125,569,070 C87F probably damaging Het
Kmt5b A G 19: 3,786,465 M1V probably null Het
Krit1 A G 5: 3,822,178 E401G probably damaging Het
Lamp1 T C 8: 13,174,491 V385A probably damaging Het
Ly6g5b A G 17: 35,114,591 Y82H probably damaging Het
Mapre2 A G 18: 23,804,175 I25V probably benign Het
Mep1a A G 17: 43,497,886 probably benign Het
Mgea5 A T 19: 45,771,888 I277N probably damaging Het
Mkrn1 A G 6: 39,399,275 W466R probably benign Het
Muc2 C A 7: 141,748,954 F11L probably benign Het
Nebl T A 2: 17,392,983 M501L probably benign Het
Olfr1151 A G 2: 87,857,483 I103V probably benign Het
Olfr1179 A G 2: 88,402,355 V193A probably benign Het
Olfr744 A G 14: 50,618,332 I37V probably benign Het
Olfr951 A G 9: 39,393,942 I50M probably benign Het
Pkd1l2 A G 8: 117,050,048 probably benign Het
Pkhd1l1 A G 15: 44,554,605 M2886V probably damaging Het
Pop5 T A 5: 115,240,171 L58H probably damaging Het
Prkch C A 12: 73,721,787 H444N possibly damaging Het
Reln T C 5: 22,004,136 D1148G probably damaging Het
Rffl G A 11: 82,812,632 T120M probably damaging Het
Rmdn2 A T 17: 79,670,569 S320C probably damaging Het
Rrbp1 C T 2: 143,989,944 R101H probably benign Het
Rtf1 G A 2: 119,726,743 R443H probably damaging Het
Serac1 G T 17: 6,048,840 L559I probably damaging Het
Slc15a3 T A 19: 10,855,986 W456R probably damaging Het
Slc35f5 C T 1: 125,576,205 P290L probably damaging Het
Slc35g2 C T 9: 100,553,117 R167Q probably benign Het
Spag4 T C 2: 156,068,042 V302A probably damaging Het
Spire2 A C 8: 123,358,097 probably benign Het
Sptbn2 G T 19: 4,724,744 V142L probably damaging Het
Syt17 T A 7: 118,409,941 D352V probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tctex1d1 T C 4: 103,002,452 probably benign Het
Thsd7a A G 6: 12,554,908 S326P probably benign Het
Tnpo2 T C 8: 85,040,628 S64P probably damaging Het
Tonsl G T 15: 76,633,485 A678D probably benign Het
Trim12c A G 7: 104,340,906 probably null Het
Tsc22d1 A G 14: 76,418,981 T885A possibly damaging Het
Ttn T C 2: 76,742,198 D26117G probably damaging Het
Ttn T A 2: 76,877,011 probably benign Het
Ugt3a1 T C 15: 9,306,256 F164L probably benign Het
Vmn2r89 A G 14: 51,455,703 N170S probably damaging Het
Vrk2 G T 11: 26,534,313 probably benign Het
Wt1 C A 2: 105,133,457 D207E probably damaging Het
Zbtb46 G A 2: 181,411,815 A368V probably benign Het
Zc3h13 A T 14: 75,323,254 D428V unknown Het
Zcchc8 C G 5: 123,707,337 G320A probably damaging Het
Znfx1 T C 2: 167,044,210 E810G possibly damaging Het
Other mutations in Slc12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Slc12a1 APN 2 125188194 missense probably damaging 1.00
IGL00845:Slc12a1 APN 2 125188238 missense probably damaging 1.00
IGL01348:Slc12a1 APN 2 125194131 missense probably damaging 1.00
IGL01534:Slc12a1 APN 2 125217910 missense probably damaging 1.00
IGL01677:Slc12a1 APN 2 125178149 splice site probably benign
IGL02150:Slc12a1 APN 2 125184815 missense probably damaging 1.00
IGL02220:Slc12a1 APN 2 125188270 critical splice donor site probably null
IGL02568:Slc12a1 APN 2 125184728 missense probably damaging 1.00
IGL02602:Slc12a1 APN 2 125154242 missense probably damaging 1.00
IGL02625:Slc12a1 APN 2 125170691 missense probably damaging 1.00
IGL02635:Slc12a1 APN 2 125225978 missense probably benign
IGL02672:Slc12a1 APN 2 125170676 missense probably damaging 1.00
IGL02718:Slc12a1 APN 2 125161079 nonsense probably null
IGL03191:Slc12a1 APN 2 125206089 missense possibly damaging 0.87
FR4449:Slc12a1 UTSW 2 125154216 small insertion probably benign
FR4548:Slc12a1 UTSW 2 125154214 small insertion probably benign
FR4737:Slc12a1 UTSW 2 125154214 small insertion probably benign
PIT4431001:Slc12a1 UTSW 2 125190204 missense possibly damaging 0.78
R0033:Slc12a1 UTSW 2 125214009 missense probably benign
R0312:Slc12a1 UTSW 2 125226028 missense probably damaging 0.98
R0373:Slc12a1 UTSW 2 125226031 missense probably damaging 1.00
R0692:Slc12a1 UTSW 2 125194162 nonsense probably null
R1194:Slc12a1 UTSW 2 125184767 missense probably benign 0.00
R1264:Slc12a1 UTSW 2 125218238 missense possibly damaging 0.56
R1529:Slc12a1 UTSW 2 125190295 missense probably damaging 1.00
R1543:Slc12a1 UTSW 2 125184857 missense possibly damaging 0.93
R1940:Slc12a1 UTSW 2 125194193 missense probably benign 0.05
R2109:Slc12a1 UTSW 2 125173699 missense probably damaging 1.00
R2167:Slc12a1 UTSW 2 125173681 missense probably damaging 1.00
R3409:Slc12a1 UTSW 2 125154151 missense probably benign 0.00
R3902:Slc12a1 UTSW 2 125188193 missense probably damaging 1.00
R4079:Slc12a1 UTSW 2 125200623 missense possibly damaging 0.86
R4502:Slc12a1 UTSW 2 125226044 missense probably damaging 1.00
R4557:Slc12a1 UTSW 2 125186641 missense probably damaging 1.00
R4719:Slc12a1 UTSW 2 125153993 missense possibly damaging 0.82
R4782:Slc12a1 UTSW 2 125161079 nonsense probably null
R4845:Slc12a1 UTSW 2 125188226 missense probably damaging 1.00
R4913:Slc12a1 UTSW 2 125228750 missense probably damaging 0.96
R5024:Slc12a1 UTSW 2 125166137 missense probably benign 0.00
R5112:Slc12a1 UTSW 2 125218224 missense possibly damaging 0.63
R5334:Slc12a1 UTSW 2 125217889 missense probably damaging 1.00
R5470:Slc12a1 UTSW 2 125170714 missense probably damaging 1.00
R6057:Slc12a1 UTSW 2 125190213 missense probably damaging 1.00
R6604:Slc12a1 UTSW 2 125184815 missense probably damaging 1.00
R6941:Slc12a1 UTSW 2 125214079 missense possibly damaging 0.85
R6944:Slc12a1 UTSW 2 125160534 missense probably damaging 0.97
R7049:Slc12a1 UTSW 2 125171257 missense probably benign 0.04
R7204:Slc12a1 UTSW 2 125200622 missense possibly damaging 0.93
R7427:Slc12a1 UTSW 2 125214132 missense probably benign
R7428:Slc12a1 UTSW 2 125214132 missense probably benign
R7432:Slc12a1 UTSW 2 125206040 missense probably benign 0.36
R7470:Slc12a1 UTSW 2 125217895 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCAATTTCCAGGTGGCAGCG -3'
(R):5'- TGGGTGGTTCTGCACATAGTGAAAG -3'

Sequencing Primer
(F):5'- gcttaactcacagttctcctacttc -3'
(R):5'- GCACATAGTGAAAGCATTTCTTTAAC -3'
Posted On2013-04-11