Incidental Mutation 'R2107:Ogg1'
ID232164
Institutional Source Beutler Lab
Gene Symbol Ogg1
Ensembl Gene ENSMUSG00000030271
Gene Name8-oxoguanine DNA-glycosylase 1
SynonymsMmh
MMRRC Submission 040111-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R2107 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113326972-113335068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 113329293 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 150 (N150K)
Ref Sequence ENSEMBL: ENSMUSP00000032406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032406] [ENSMUST00000032409] [ENSMUST00000113117] [ENSMUST00000113119] [ENSMUST00000113121] [ENSMUST00000113122] [ENSMUST00000136263] [ENSMUST00000203577] [ENSMUST00000204198] [ENSMUST00000204626] [ENSMUST00000204834]
Predicted Effect probably damaging
Transcript: ENSMUST00000032406
AA Change: N150K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032406
Gene: ENSMUSG00000030271
AA Change: N150K

DomainStartEndE-ValueType
Pfam:OGG_N 25 141 4e-38 PFAM
ENDO3c 146 316 4.84e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032409
SMART Domains Protein: ENSMUSP00000032409
Gene: ENSMUSG00000030272

DomainStartEndE-ValueType
S_TKc 20 276 5.03e-111 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 358 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113117
SMART Domains Protein: ENSMUSP00000108742
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 1e-35 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
low complexity region 1078 1090 N/A INTRINSIC
PWWP 1115 1198 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113119
SMART Domains Protein: ENSMUSP00000108744
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 8.5e-39 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
PWWP 1116 1199 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113121
SMART Domains Protein: ENSMUSP00000108746
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
PWWP 1082 1165 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113122
SMART Domains Protein: ENSMUSP00000108747
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
PWWP 1081 1164 4.1e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131594
Predicted Effect probably benign
Transcript: ENSMUST00000136263
SMART Domains Protein: ENSMUSP00000144792
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Pfam:OGG_N 25 130 3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147945
SMART Domains Protein: ENSMUSP00000116265
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Blast:ENDO3c 7 75 7e-46 BLAST
PDB:1KO9|A 7 104 1e-55 PDB
SCOP:d1ko9a1 8 82 1e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156734
Predicted Effect probably benign
Transcript: ENSMUST00000203577
SMART Domains Protein: ENSMUSP00000144820
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 5.1e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
low complexity region 1084 1096 N/A INTRINSIC
PWWP 1121 1204 2.6e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203721
Predicted Effect probably benign
Transcript: ENSMUST00000204198
SMART Domains Protein: ENSMUSP00000144804
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.4e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1e-39 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 899 925 N/A INTRINSIC
PWWP 987 1070 2.6e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204626
SMART Domains Protein: ENSMUSP00000145093
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.9e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
PWWP 1087 1170 2.6e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204834
SMART Domains Protein: ENSMUSP00000144905
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Pfam:OGG_N 25 134 1.2e-27 PFAM
Meta Mutation Damage Score 0.8778 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to accumulation of 8-hydroxyguanine and altered DNA repair. Mice homozygous for a knock-out allele remain healthy until at least 18 months of age. Mice homozygous for another knock-out allele develop spontaneouslung adenoma/carcinoma at ~1.5 years of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik A T 2: 30,795,732 L364Q probably damaging Het
9030624J02Rik T C 7: 118,794,539 probably benign Het
A2m C A 6: 121,654,612 L623M probably benign Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Acp2 G A 2: 91,203,595 probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Cblb T A 16: 52,152,716 probably null Het
Ccdc88c G T 12: 100,921,549 D1557E probably benign Het
Cdc20 T C 4: 118,433,513 Y430C probably damaging Het
Cdk5rap1 C T 2: 154,353,246 D350N probably benign Het
Cgrrf1 T A 14: 46,853,376 probably benign Het
Chia1 T A 3: 106,128,840 Y185* probably null Het
Cmtm8 A T 9: 114,796,108 V85D possibly damaging Het
Cplx4 A G 18: 65,956,893 S152P probably benign Het
Crmp1 G T 5: 37,242,494 R117L probably benign Het
Csad G C 15: 102,179,034 L365V probably null Het
Dyrk1a C T 16: 94,686,527 T532M probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam208a T A 14: 27,461,787 probably null Het
Fan1 T G 7: 64,366,788 R529S probably damaging Het
Fbln5 A G 12: 101,771,269 W173R probably damaging Het
Gm9611 A T 14: 42,294,654 N42K possibly damaging Het
Gnal T A 18: 67,213,578 L257Q probably damaging Het
Hint3 A T 10: 30,618,256 F33I probably damaging Het
Ipcef1 A G 10: 6,890,501 S403P probably benign Het
Kmt2c T C 5: 25,309,824 N3007S probably benign Het
Kpna3 T C 14: 61,370,484 D424G possibly damaging Het
Krt90 A G 15: 101,562,629 I66T probably benign Het
Lamc2 A G 1: 153,154,386 probably benign Het
Lmtk3 G T 7: 45,793,969 C692F possibly damaging Het
Lrguk T C 6: 34,062,361 M269T probably benign Het
Lrrc19 T A 4: 94,639,294 T227S probably benign Het
Lrrk1 C A 7: 66,279,282 D1201Y probably damaging Het
Matn2 T A 15: 34,423,759 Y588N probably damaging Het
Mmp1b A G 9: 7,369,310 W346R probably damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mprip A G 11: 59,769,891 K2166R probably damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nedd9 A T 13: 41,338,979 C12* probably null Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nisch C T 14: 31,172,140 V172I probably damaging Het
Npy2r A T 3: 82,541,129 probably null Het
Olfr350 C A 2: 36,850,343 A99E possibly damaging Het
Olfr59 T C 11: 74,289,390 V248A probably damaging Het
Olfr818 A G 10: 129,945,712 S2P probably damaging Het
Pck1 G C 2: 173,154,068 E120Q probably benign Het
Pde11a A G 2: 76,337,922 V229A probably damaging Het
Pias2 T C 18: 77,097,471 F83L probably benign Het
Plagl1 A C 10: 13,128,647 probably benign Het
Plin3 A T 17: 56,284,391 S130T probably benign Het
Rcc2 A G 4: 140,721,185 Y515C probably damaging Het
Rgs12 A G 5: 34,966,735 K621E possibly damaging Het
Rnf6 G A 5: 146,211,281 T309I probably damaging Het
Rpusd3 G T 6: 113,415,562 T335N probably damaging Het
Scn8a A T 15: 101,018,363 I1218F probably damaging Het
Slc23a1 T A 18: 35,625,826 Q104L possibly damaging Het
Slc34a3 A T 2: 25,230,987 V363D probably damaging Het
Smap1 A T 1: 23,848,454 M248K possibly damaging Het
Sp1 A G 15: 102,409,678 probably null Het
Tbc1d1 T G 5: 64,284,705 N689K probably benign Het
Tff2 T C 17: 31,142,282 E99G possibly damaging Het
Tjp3 T C 10: 81,280,544 N239D possibly damaging Het
Trim37 G A 11: 87,159,825 R230Q probably benign Het
Ubr5 A G 15: 37,989,302 M2090T probably benign Het
Unc13a T C 8: 71,656,251 probably null Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vav2 T C 2: 27,267,303 E829G probably damaging Het
Zfp26 A T 9: 20,442,237 D85E probably benign Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Other mutations in Ogg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03171:Ogg1 APN 6 113333414 missense possibly damaging 0.90
IGL03180:Ogg1 APN 6 113333494 critical splice donor site probably null
R0270:Ogg1 UTSW 6 113329256 missense probably benign 0.00
R0883:Ogg1 UTSW 6 113328420 missense probably damaging 1.00
R3618:Ogg1 UTSW 6 113328373 missense probably damaging 1.00
R3771:Ogg1 UTSW 6 113333843 missense possibly damaging 0.47
R4609:Ogg1 UTSW 6 113328432 missense probably damaging 0.99
R4673:Ogg1 UTSW 6 113327307 missense probably damaging 1.00
R5580:Ogg1 UTSW 6 113329376 missense probably damaging 1.00
R7028:Ogg1 UTSW 6 113329276 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTAGTGATTTCTCGACC -3'
(R):5'- CAGTGGGAAGCTCTGAGATG -3'

Sequencing Primer
(F):5'- GACCCGAGCAGTCCCTTATTC -3'
(R):5'- CTCATAGCTTGGGTAGAACTGAAC -3'
Posted On2014-09-18