Incidental Mutation 'R2161:Olfr1462'
ID 235182
Institutional Source Beutler Lab
Gene Symbol Olfr1462
Ensembl Gene ENSMUSG00000094721
Gene Name olfactory receptor 1462
Synonyms GA_x6K02T2RE5P-3517488-3518411, MOR202-13
MMRRC Submission 040164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R2161 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 13185734-13193775 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13191309 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 214 (I214K)
Ref Sequence ENSEMBL: ENSMUSP00000147174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076832] [ENSMUST00000208533]
AlphaFold Q8VFW3
Predicted Effect probably damaging
Transcript: ENSMUST00000076832
AA Change: I214K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076107
Gene: ENSMUSG00000094721
AA Change: I214K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-51 PFAM
Pfam:7tm_1 39 288 6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208533
AA Change: I214K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik T C 8: 36,505,650 C85R probably damaging Het
Adamts12 A G 15: 11,215,735 M281V probably damaging Het
Ap1g1 A T 8: 109,844,354 D423V probably damaging Het
Arel1 A G 12: 84,921,256 probably null Het
Arhgap33 T C 7: 30,528,650 probably null Het
Arhgef18 T G 8: 3,439,575 Y302* probably null Het
Blm T C 7: 80,481,370 probably null Het
Cep295 T G 9: 15,353,058 E97D probably damaging Het
Cep295nl T C 11: 118,332,509 D503G possibly damaging Het
Chchd2 G T 5: 129,884,148 A29E probably damaging Het
Cic A G 7: 25,288,134 probably null Het
Cmtr1 C T 17: 29,702,173 L798F probably benign Het
Col11a2 C A 17: 34,064,797 probably benign Het
Crispld2 A G 8: 120,015,339 Y142C probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dsp G A 13: 38,196,451 D1792N probably damaging Het
Esp4 C A 17: 40,602,393 N50K probably benign Het
Fbxo21 T C 5: 117,995,386 S404P probably damaging Het
Ggnbp2 A G 11: 84,834,433 F639L probably benign Het
Golph3l G A 3: 95,617,125 G229D probably damaging Het
Hlx G T 1: 184,727,641 S433R probably benign Het
Kdm2b T A 5: 122,880,699 S233C probably damaging Het
Krt14 C T 11: 100,207,113 G115R unknown Het
Ldb3 A G 14: 34,567,396 probably null Het
Lrp1 T A 10: 127,555,738 E2937D probably damaging Het
Mark2 G C 19: 7,282,747 S111C probably damaging Het
Naa20 T A 2: 145,911,795 probably null Het
Ndufa8 A T 2: 36,036,515 W170R probably damaging Het
Nlrp2 A T 7: 5,325,042 L671I probably damaging Het
Olfr603 T A 7: 103,383,200 R267S probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpro A G 6: 137,449,887 D280G probably benign Het
Reps1 A G 10: 18,096,283 E361G probably damaging Het
Rgs6 A G 12: 83,091,804 E304G probably damaging Het
Siglece T C 7: 43,659,369 T187A probably benign Het
Slc5a10 C T 11: 61,719,934 G5R probably null Het
Sohlh1 A G 2: 25,844,636 I215T probably benign Het
Stag1 T A 9: 100,889,595 V691D probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tmed8 A G 12: 87,174,257 V185A probably damaging Het
Trim71 A G 9: 114,512,772 F814S probably damaging Het
Tsnax A T 8: 125,015,689 K52N probably damaging Het
Tubgcp3 T C 8: 12,632,292 T676A probably benign Het
Other mutations in Olfr1462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Olfr1462 APN 19 13191234 missense possibly damaging 0.60
IGL01999:Olfr1462 APN 19 13191560 missense probably damaging 0.99
IGL02326:Olfr1462 APN 19 13191415 nonsense probably null
IGL03381:Olfr1462 APN 19 13191405 missense probably damaging 0.98
R1184:Olfr1462 UTSW 19 13191375 missense probably damaging 0.99
R1434:Olfr1462 UTSW 19 13191298 missense probably benign 0.19
R2399:Olfr1462 UTSW 19 13191345 missense probably benign 0.02
R4583:Olfr1462 UTSW 19 13190698 missense probably damaging 1.00
R5937:Olfr1462 UTSW 19 13191311 missense probably damaging 1.00
R7164:Olfr1462 UTSW 19 13190906 missense probably benign 0.00
R7270:Olfr1462 UTSW 19 13191404 missense possibly damaging 0.90
R7645:Olfr1462 UTSW 19 13191573 missense probably benign 0.01
R7649:Olfr1462 UTSW 19 13190772 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTAAGCCCCTACATTATGCCAC -3'
(R):5'- TGTCAGTGTCCATGGAGTGAC -3'

Sequencing Primer
(F):5'- CTGAATGCTTCCATCTATACAGTGG -3'
(R):5'- ACTGGAGGTTGGCTGCAAGTAC -3'
Posted On 2014-10-01