Incidental Mutation 'R1434:Olfr1462'
ID 159418
Institutional Source Beutler Lab
Gene Symbol Olfr1462
Ensembl Gene ENSMUSG00000094721
Gene Name olfactory receptor 1462
Synonyms GA_x6K02T2RE5P-3517488-3518411, MOR202-13
MMRRC Submission 039489-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R1434 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 13185734-13193775 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 13191298 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 210 (I210M)
Ref Sequence ENSEMBL: ENSMUSP00000147174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076832] [ENSMUST00000208533]
AlphaFold Q8VFW3
Predicted Effect probably benign
Transcript: ENSMUST00000076832
AA Change: I210M

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076107
Gene: ENSMUSG00000094721
AA Change: I210M

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-51 PFAM
Pfam:7tm_1 39 288 6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208533
AA Change: I210M

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,639 probably benign Het
Abca12 G T 1: 71,309,800 H851N probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Ankhd1 A G 18: 36,625,159 I969V probably benign Het
Apob A G 12: 8,009,715 I2699M probably damaging Het
Aqr A T 2: 114,150,409 L297Q probably damaging Het
BC067074 G A 13: 113,368,492 V510I possibly damaging Het
Camsap1 A G 2: 25,945,178 Y301H probably damaging Het
Ccdc88c A G 12: 100,939,166 probably benign Het
Cd209b T A 8: 3,923,367 I106F possibly damaging Het
Cdkn1b T A 6: 134,921,097 W60R probably damaging Het
Coasy A G 11: 101,084,996 probably benign Het
Col2a1 T A 15: 97,979,651 Q1017L probably damaging Het
Ctnnal1 T A 4: 56,847,971 N56I probably damaging Het
Cyb561d2 T A 9: 107,541,643 probably benign Het
Dcst1 G T 3: 89,352,519 T632N probably damaging Het
Ddx1 C T 12: 13,237,231 V267I probably benign Het
Dnah10 A T 5: 124,774,986 M1736L probably benign Het
Eln G A 5: 134,729,437 probably benign Het
Enpp2 A T 15: 54,862,681 D566E probably damaging Het
Ezh1 T C 11: 101,194,917 K638R probably damaging Het
Fam172a A T 13: 77,761,922 Y98F probably damaging Het
Fdx1l C A 9: 21,073,398 G37W probably benign Het
Grin2b T C 6: 135,843,195 I340V probably benign Het
Ikbkap T A 4: 56,781,193 E493D probably benign Het
Il16 T C 7: 83,655,312 T671A probably benign Het
Kcnd2 T A 6: 21,216,357 M20K probably damaging Het
Kndc1 C T 7: 139,922,684 S962F probably damaging Het
L1td1 A G 4: 98,737,817 S750G possibly damaging Het
Lama2 A G 10: 27,208,370 C935R probably damaging Het
Lgalsl T C 11: 20,826,418 D158G possibly damaging Het
Lman1 A T 18: 65,993,073 probably null Het
Lmtk2 A G 5: 144,174,589 E709G probably damaging Het
Lrfn3 T C 7: 30,355,927 H531R possibly damaging Het
Mark3 A G 12: 111,623,325 probably benign Het
Mov10 T C 3: 104,795,174 E997G probably damaging Het
Myo15 T A 11: 60,504,331 W2484R probably benign Het
Myo1g G T 11: 6,509,372 Q833K probably benign Het
Ncoa3 T A 2: 166,055,510 D740E probably benign Het
Nol12 A G 15: 78,937,953 probably benign Het
Nrxn2 T A 19: 6,443,612 probably null Het
Nsfl1c A C 2: 151,500,746 I79L probably benign Het
Olfr173 G T 16: 58,797,448 H133N probably benign Het
Olfr691 T C 7: 105,337,261 I152V probably benign Het
Osbpl8 A C 10: 111,291,581 E842A probably benign Het
Pdxk G T 10: 78,440,811 T310K probably benign Het
Phip T G 9: 82,959,605 K54Q probably damaging Het
Pklr A T 3: 89,143,035 D366V probably damaging Het
Plxna2 T A 1: 194,751,540 probably benign Het
Ppp4r3a A T 12: 101,043,524 V618E probably damaging Het
Prdm12 A T 2: 31,640,307 Q70L possibly damaging Het
Ptpn21 A T 12: 98,688,590 M706K probably damaging Het
Ptprq A T 10: 107,586,714 F1606I probably damaging Het
Rasgrp4 T C 7: 29,137,727 probably null Het
Rlbp1 C A 7: 79,379,913 probably null Het
Rtp2 T C 16: 23,927,443 D166G probably benign Het
Ryr3 A C 2: 112,645,259 F4481V probably damaging Het
Scn2a A G 2: 65,701,991 D649G possibly damaging Het
Slc30a5 T A 13: 100,803,442 D655V probably damaging Het
Slco5a1 G A 1: 12,871,908 A838V probably benign Het
Srprb A G 9: 103,190,302 V239A probably damaging Het
Tceanc2 T C 4: 107,147,640 T104A probably benign Het
Tcp1 T C 17: 12,922,606 probably null Het
Unc13b C T 4: 43,239,385 R1056* probably null Het
Wdr19 G A 5: 65,223,504 probably benign Het
Zadh2 A G 18: 84,094,471 K91E probably benign Het
Zfhx4 T A 3: 5,241,859 H48Q probably benign Het
Zfp787 T A 7: 6,132,235 H339L probably damaging Het
Zfp839 G T 12: 110,860,899 R408L probably benign Het
Other mutations in Olfr1462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Olfr1462 APN 19 13191234 missense possibly damaging 0.60
IGL01999:Olfr1462 APN 19 13191560 missense probably damaging 0.99
IGL02326:Olfr1462 APN 19 13191415 nonsense probably null
IGL03381:Olfr1462 APN 19 13191405 missense probably damaging 0.98
R1184:Olfr1462 UTSW 19 13191375 missense probably damaging 0.99
R2161:Olfr1462 UTSW 19 13191309 missense probably damaging 0.99
R2399:Olfr1462 UTSW 19 13191345 missense probably benign 0.02
R4583:Olfr1462 UTSW 19 13190698 missense probably damaging 1.00
R5937:Olfr1462 UTSW 19 13191311 missense probably damaging 1.00
R7164:Olfr1462 UTSW 19 13190906 missense probably benign 0.00
R7270:Olfr1462 UTSW 19 13191404 missense possibly damaging 0.90
R7645:Olfr1462 UTSW 19 13191573 missense probably benign 0.01
R7649:Olfr1462 UTSW 19 13190772 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGTAAGCCCCTACATTATGCCACC -3'
(R):5'- CATGCTGTAGACCAGAGGGTTCAAC -3'

Sequencing Primer
(F):5'- ACATTTGTGGTTTCCTGAATGC -3'
(R):5'- CAGACACAATTTTGTCAGTGTCC -3'
Posted On 2014-03-14