Incidental Mutation 'R2250:Mindy4'
ID240821
Institutional Source Beutler Lab
Gene Symbol Mindy4
Ensembl Gene ENSMUSG00000038022
Gene NameMINDY lysine 48 deubiquitinase 4
SynonymsC330043M08Rik, LOC384387, Fam188b
MMRRC Submission 040250-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2250 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location55203383-55320222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55300949 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 593 (V593I)
Ref Sequence ENSEMBL: ENSMUSP00000061221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053094]
Predicted Effect probably damaging
Transcript: ENSMUST00000053094
AA Change: V593I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061221
Gene: ENSMUSG00000038022
AA Change: V593I

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
low complexity region 265 277 N/A INTRINSIC
DUF4205 403 739 1.47e-187 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204173
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,451,939 C532R probably damaging Het
Edem2 A C 2: 155,710,973 probably null Het
Hhatl A G 9: 121,788,171 V332A possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Irf2bp1 G T 7: 19,005,799 A455S probably benign Het
Lyg2 G A 1: 37,915,735 L10F probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nectin3 A T 16: 46,454,736 D319E probably benign Het
Olfr589 C A 7: 103,154,950 G266C probably damaging Het
Olfr6 T A 7: 106,956,373 M188L probably benign Het
Plcb4 G A 2: 135,971,861 probably null Het
Prkd3 T C 17: 78,968,078 T446A probably benign Het
Scn11a T A 9: 119,758,602 T1359S probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spta1 A G 1: 174,244,114 E2220G probably damaging Het
Strn4 A G 7: 16,826,466 Y181C probably damaging Het
Vmn1r119 A T 7: 21,012,259 L66H probably damaging Het
Other mutations in Mindy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Mindy4 APN 6 55284742 splice site probably benign
IGL01483:Mindy4 APN 6 55216685 missense probably damaging 1.00
IGL01721:Mindy4 APN 6 55223999 missense probably damaging 1.00
IGL01965:Mindy4 APN 6 55260532 splice site probably benign
IGL02214:Mindy4 APN 6 55216651 missense possibly damaging 0.88
IGL03058:Mindy4 APN 6 55308198 missense probably damaging 1.00
IGL03077:Mindy4 APN 6 55309330 missense probably damaging 1.00
IGL03296:Mindy4 APN 6 55297753 critical splice donor site probably null
R0383:Mindy4 UTSW 6 55276634 missense probably benign 0.00
R0384:Mindy4 UTSW 6 55216684 missense probably damaging 1.00
R0636:Mindy4 UTSW 6 55276585 missense possibly damaging 0.73
R0848:Mindy4 UTSW 6 55318286 nonsense probably null
R1171:Mindy4 UTSW 6 55255616 missense possibly damaging 0.75
R1210:Mindy4 UTSW 6 55284813 missense possibly damaging 0.92
R1341:Mindy4 UTSW 6 55255616 missense probably benign 0.00
R2030:Mindy4 UTSW 6 55211262 missense probably damaging 1.00
R2127:Mindy4 UTSW 6 55218265 missense probably benign 0.05
R2237:Mindy4 UTSW 6 55301070 missense probably damaging 1.00
R2238:Mindy4 UTSW 6 55301070 missense probably damaging 1.00
R2571:Mindy4 UTSW 6 55284785 missense probably damaging 1.00
R2846:Mindy4 UTSW 6 55278100 missense probably damaging 1.00
R3001:Mindy4 UTSW 6 55218364 missense probably benign 0.21
R3002:Mindy4 UTSW 6 55218364 missense probably benign 0.21
R3498:Mindy4 UTSW 6 55216525 missense probably benign 0.01
R4167:Mindy4 UTSW 6 55224346 missense possibly damaging 0.93
R4767:Mindy4 UTSW 6 55260565 missense probably damaging 0.98
R4812:Mindy4 UTSW 6 55279103 missense possibly damaging 0.64
R5109:Mindy4 UTSW 6 55216745 splice site probably null
R5203:Mindy4 UTSW 6 55255661 missense probably benign 0.00
R5221:Mindy4 UTSW 6 55224107 missense probably benign
R5628:Mindy4 UTSW 6 55260594 missense probably damaging 0.98
R6265:Mindy4 UTSW 6 55301064 missense probably damaging 0.99
R6596:Mindy4 UTSW 6 55224016 missense probably damaging 0.99
R7084:Mindy4 UTSW 6 55278235 missense probably benign
R7350:Mindy4 UTSW 6 55301025 missense probably damaging 0.97
R7535:Mindy4 UTSW 6 55297753 critical splice donor site probably null
R7625:Mindy4 UTSW 6 55276613 missense possibly damaging 0.95
R8052:Mindy4 UTSW 6 55300992 missense probably damaging 0.99
X0065:Mindy4 UTSW 6 55262816 missense probably damaging 0.99
Z1177:Mindy4 UTSW 6 55224341 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAAGCAGTTGGTAGATTTCTCCC -3'
(R):5'- AGAATAAGGTCGCTGGGGTTC -3'

Sequencing Primer
(F):5'- GGTAGATTTCTCCCAACAGAGCCTG -3'
(R):5'- CTGGAGTGCCTTTGGGTAC -3'
Posted On2014-10-15