Incidental Mutation 'R2337:Ccdc14'
ID246600
Institutional Source Beutler Lab
Gene Symbol Ccdc14
Ensembl Gene ENSMUSG00000022833
Gene Namecoiled-coil domain containing 14
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R2337 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location34690616-34725202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34705018 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 179 (H179R)
Ref Sequence ENSEMBL: ENSMUSP00000156124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023532] [ENSMUST00000231609]
Predicted Effect probably benign
Transcript: ENSMUST00000023532
AA Change: H227R

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023532
Gene: ENSMUSG00000022833
AA Change: H227R

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:CCDC14 96 934 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231364
Predicted Effect probably benign
Transcript: ENSMUST00000231609
AA Change: H179R

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232489
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
9930111J21Rik2 T C 11: 49,020,304 N434S probably benign Het
Acaca T C 11: 84,257,197 S691P possibly damaging Het
Arid5b T C 10: 68,097,777 D765G possibly damaging Het
Ccdc177 C T 12: 80,758,691 A270T unknown Het
Cdh16 G T 8: 104,622,270 T65K probably benign Het
Dag1 G T 9: 108,207,397 Y848* probably null Het
Dnhd1 C T 7: 105,703,467 T2609I probably benign Het
Fat4 A G 3: 38,980,011 Y2604C probably damaging Het
Fhad1 T C 4: 141,922,344 D164G possibly damaging Het
Fnip1 G A 11: 54,475,737 D109N probably damaging Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm2046 T A 12: 87,980,178 V130E unknown Het
Gsap T A 5: 21,288,630 I755N probably damaging Het
Hdgfl2 T C 17: 56,096,987 V281A possibly damaging Het
Hmg20b T C 10: 81,348,513 E50G probably damaging Het
Myo5a A G 9: 75,203,801 D1498G probably damaging Het
Poc5 T C 13: 96,410,603 V458A probably damaging Het
Tada2b T C 5: 36,476,914 M107V probably benign Het
Tle6 T C 10: 81,592,656 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Other mutations in Ccdc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Ccdc14 APN 16 34723213 missense probably damaging 1.00
IGL02338:Ccdc14 APN 16 34721803 missense probably benign 0.00
IGL02494:Ccdc14 APN 16 34723414 missense probably damaging 1.00
IGL02648:Ccdc14 APN 16 34697158 missense probably damaging 1.00
R0632:Ccdc14 UTSW 16 34721649 missense possibly damaging 0.86
R1199:Ccdc14 UTSW 16 34723828 missense probably damaging 1.00
R1469:Ccdc14 UTSW 16 34706782 missense probably damaging 0.99
R1469:Ccdc14 UTSW 16 34706782 missense probably damaging 0.99
R2012:Ccdc14 UTSW 16 34690722 missense possibly damaging 0.83
R2087:Ccdc14 UTSW 16 34695645 critical splice donor site probably null
R2504:Ccdc14 UTSW 16 34721850 nonsense probably null
R3155:Ccdc14 UTSW 16 34723852 missense probably damaging 1.00
R4618:Ccdc14 UTSW 16 34706495 missense probably benign 0.08
R4645:Ccdc14 UTSW 16 34721740 missense probably damaging 1.00
R4835:Ccdc14 UTSW 16 34705038 missense probably damaging 1.00
R5186:Ccdc14 UTSW 16 34721585 missense probably damaging 1.00
R5214:Ccdc14 UTSW 16 34704855 missense probably benign 0.24
R5319:Ccdc14 UTSW 16 34723172 missense probably damaging 0.99
R5921:Ccdc14 UTSW 16 34706391 missense probably damaging 0.99
R5945:Ccdc14 UTSW 16 34723588 missense probably damaging 1.00
R6141:Ccdc14 UTSW 16 34706562 missense probably damaging 1.00
R6662:Ccdc14 UTSW 16 34690794 missense probably damaging 1.00
R6925:Ccdc14 UTSW 16 34690749 missense probably benign 0.29
R6958:Ccdc14 UTSW 16 34690806 missense probably damaging 1.00
R6970:Ccdc14 UTSW 16 34709533 missense probably damaging 1.00
R7365:Ccdc14 UTSW 16 34723619 nonsense probably null
Z1088:Ccdc14 UTSW 16 34690804 start codon destroyed probably null 0.98
Predicted Primers PCR Primer
(F):5'- GGTACACATGAATTTTGACTGGG -3'
(R):5'- CCAGAATGTGGTGTTGCCTG -3'

Sequencing Primer
(F):5'- CACATGAATTTTGACTGGGGAAAC -3'
(R):5'- TGTTGCCTGAGAGCCTACG -3'
Posted On2014-10-30