Incidental Mutation 'R2373:Fzd5'
ID248188
Institutional Source Beutler Lab
Gene Symbol Fzd5
Ensembl Gene ENSMUSG00000045005
Gene Namefrizzled class receptor 5
SynonymsFz5, 5330434N09Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2373 (G1)
Quality Score169
Status Not validated
Chromosome1
Chromosomal Location64730558-64737751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64734907 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 565 (G565D)
Ref Sequence ENSEMBL: ENSMUSP00000111828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063982] [ENSMUST00000116133]
Predicted Effect probably damaging
Transcript: ENSMUST00000063982
AA Change: G565D

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067783
Gene: ENSMUSG00000045005
AA Change: G565D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FRI 32 152 1.28e-72 SMART
low complexity region 170 188 N/A INTRINSIC
Frizzled 225 540 2.48e-217 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116133
AA Change: G565D

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111828
Gene: ENSMUSG00000045005
AA Change: G565D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FRI 32 152 1.28e-72 SMART
low complexity region 170 188 N/A INTRINSIC
Frizzled 225 540 2.48e-217 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194323
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD5 protein is believed to be the receptor for the Wnt5A ligand. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die as embryos. Extra embryonic vascular development is abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9130023H24Rik A T 7: 128,237,315 D35E probably benign Het
9330159F19Rik A G 10: 29,225,043 N471D probably benign Het
Ahctf1 A T 1: 179,795,796 F86I probably damaging Het
Alpk1 T C 3: 127,679,808 T849A probably benign Het
Arfgef1 A T 1: 10,174,142 D965E probably damaging Het
Asxl1 A G 2: 153,401,900 T1458A probably benign Het
Cdc42bpa A T 1: 180,111,784 M876L possibly damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Col12a1 A T 9: 79,656,813 V1710E probably benign Het
Corin G A 5: 72,339,038 S524L probably damaging Het
Dennd2c A G 3: 103,156,842 H658R probably damaging Het
Disp3 A G 4: 148,258,795 V553A probably damaging Het
Dpm2 T C 2: 32,572,445 F81S probably benign Het
Emc2 T A 15: 43,513,758 I239N probably damaging Het
Fam160a1 C T 3: 85,676,097 W464* probably null Het
Gpld1 T C 13: 24,962,856 F267S probably benign Het
Kif14 C A 1: 136,479,845 A46E probably damaging Het
Mta3 G T 17: 83,784,301 E179* probably null Het
Ninl T G 2: 150,980,117 T22P probably damaging Het
Pcnx2 T C 8: 125,753,451 N2039S probably damaging Het
Rc3h2 A G 2: 37,379,001 S818P possibly damaging Het
Scn11a T A 9: 119,813,186 E162D probably benign Het
Slc5a7 A T 17: 54,277,126 W379R probably damaging Het
Sptb C T 12: 76,621,161 V721M probably damaging Het
Vmn1r82 T A 7: 12,305,055 V85E probably damaging Het
Vmn2r93 T A 17: 18,298,403 F41L probably benign Het
Vmn2r-ps130 T C 17: 23,061,506 I47T possibly damaging Het
Other mutations in Fzd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Fzd5 APN 1 64735946 missense possibly damaging 0.81
IGL02015:Fzd5 APN 1 64736342 missense probably damaging 1.00
IGL02673:Fzd5 APN 1 64735106 missense possibly damaging 0.48
R0060:Fzd5 UTSW 1 64735676 missense probably benign 0.01
R1860:Fzd5 UTSW 1 64734994 missense probably damaging 1.00
R1884:Fzd5 UTSW 1 64735654 missense probably damaging 1.00
R3114:Fzd5 UTSW 1 64735580 missense probably benign 0.45
R3725:Fzd5 UTSW 1 64736339 missense probably damaging 1.00
R4972:Fzd5 UTSW 1 64736012 missense probably benign 0.06
R5154:Fzd5 UTSW 1 64735972 missense probably benign 0.05
R5441:Fzd5 UTSW 1 64735417 missense probably benign 0.43
R6122:Fzd5 UTSW 1 64735656 nonsense probably null
R6748:Fzd5 UTSW 1 64735564 missense possibly damaging 0.89
R7322:Fzd5 UTSW 1 64735328 missense probably damaging 1.00
R7526:Fzd5 UTSW 1 64736092 missense probably benign 0.01
R7543:Fzd5 UTSW 1 64735840 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTAATCTCTTGAAACCGCCCC -3'
(R):5'- AAGTACTTCATGTGCCTGGTGG -3'

Sequencing Primer
(F):5'- TCCAAGCCACTCTGGGAG -3'
(R):5'- TGGTGGGCATCACGTCG -3'
Posted On2014-11-11