Incidental Mutation 'R2373:Vmn1r82'
ID248202
Institutional Source Beutler Lab
Gene Symbol Vmn1r82
Ensembl Gene ENSMUSG00000058132
Gene Namevomeronasal 1 receptor 82
SynonymsV1rg12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2373 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12300430-12308582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12305055 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 85 (V85E)
Ref Sequence ENSEMBL: ENSMUSP00000140782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072801] [ENSMUST00000191002] [ENSMUST00000227672]
Predicted Effect probably damaging
Transcript: ENSMUST00000072801
AA Change: V84E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072580
Gene: ENSMUSG00000058132
AA Change: V84E

DomainStartEndE-ValueType
Pfam:V1R 35 295 1.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191002
AA Change: V85E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140782
Gene: ENSMUSG00000058132
AA Change: V85E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:V1R 36 296 8.4e-27 PFAM
Pfam:7tm_1 39 290 2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227672
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9130023H24Rik A T 7: 128,237,315 D35E probably benign Het
9330159F19Rik A G 10: 29,225,043 N471D probably benign Het
Ahctf1 A T 1: 179,795,796 F86I probably damaging Het
Alpk1 T C 3: 127,679,808 T849A probably benign Het
Arfgef1 A T 1: 10,174,142 D965E probably damaging Het
Asxl1 A G 2: 153,401,900 T1458A probably benign Het
Cdc42bpa A T 1: 180,111,784 M876L possibly damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Col12a1 A T 9: 79,656,813 V1710E probably benign Het
Corin G A 5: 72,339,038 S524L probably damaging Het
Dennd2c A G 3: 103,156,842 H658R probably damaging Het
Disp3 A G 4: 148,258,795 V553A probably damaging Het
Dpm2 T C 2: 32,572,445 F81S probably benign Het
Emc2 T A 15: 43,513,758 I239N probably damaging Het
Fam160a1 C T 3: 85,676,097 W464* probably null Het
Fzd5 C T 1: 64,734,907 G565D probably damaging Het
Gpld1 T C 13: 24,962,856 F267S probably benign Het
Kif14 C A 1: 136,479,845 A46E probably damaging Het
Mta3 G T 17: 83,784,301 E179* probably null Het
Ninl T G 2: 150,980,117 T22P probably damaging Het
Pcnx2 T C 8: 125,753,451 N2039S probably damaging Het
Rc3h2 A G 2: 37,379,001 S818P possibly damaging Het
Scn11a T A 9: 119,813,186 E162D probably benign Het
Slc5a7 A T 17: 54,277,126 W379R probably damaging Het
Sptb C T 12: 76,621,161 V721M probably damaging Het
Vmn2r93 T A 17: 18,298,403 F41L probably benign Het
Vmn2r-ps130 T C 17: 23,061,506 I47T possibly damaging Het
Other mutations in Vmn1r82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Vmn1r82 APN 7 12305169 missense probably damaging 0.99
IGL01955:Vmn1r82 APN 7 12305723 unclassified probably null
IGL02267:Vmn1r82 APN 7 12305346 missense probably damaging 1.00
R0336:Vmn1r82 UTSW 7 12305321 missense probably benign 0.26
R2849:Vmn1r82 UTSW 7 12305406 missense probably damaging 1.00
R4621:Vmn1r82 UTSW 7 12305336 missense possibly damaging 0.71
R5628:Vmn1r82 UTSW 7 12305278 missense probably damaging 1.00
R6180:Vmn1r82 UTSW 7 12305085 missense probably damaging 0.97
R6263:Vmn1r82 UTSW 7 12305534 missense probably damaging 1.00
R6877:Vmn1r82 UTSW 7 12305363 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GGGTATAGTCTTCATCCTGCAG -3'
(R):5'- GAAGCAGATTCATAGGCCAAC -3'

Sequencing Primer
(F):5'- TGCAGACTACTGTAGGAATCCTG -3'
(R):5'- TTCATAGGCCAACTGAGTGAGC -3'
Posted On2014-11-11