Incidental Mutation 'R2373:Slc5a7'
ID248215
Institutional Source Beutler Lab
Gene Symbol Slc5a7
Ensembl Gene ENSMUSG00000023945
Gene Namesolute carrier family 5 (choline transporter), member 7
SynonymsCHT1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2373 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location54273594-54299034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54277126 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 379 (W379R)
Ref Sequence ENSEMBL: ENSMUSP00000093379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095712]
Predicted Effect probably damaging
Transcript: ENSMUST00000095712
AA Change: W379R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093379
Gene: ENSMUSG00000023945
AA Change: W379R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:SSF 42 442 4.7e-36 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium ion- and chloride ion-dependent high-affinity transporter that mediates choline uptake for acetylcholine synthesis in cholinergic neurons. The protein transports choline from the extracellular space into presynaptic terminals for synthesis into acetylcholine. Increased choline uptake results from increased density of this protein in synaptosomal plasma membranes in response to depolarization of cholinergic terminals. Dysfunction of cholinergic signaling has been implicated in various disorders including depression, attention-deficit disorder, and schizophrenia. An allelic variant of this gene is associated with autosomal dominant distal hereditary motor neuronopathy type VIIA. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice display neonatal lethality with respiratory failure, hyporesponsiveness to touch, inability to sustain acetylcholine release, and abnormal neuromuscular junction morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9130023H24Rik A T 7: 128,237,315 D35E probably benign Het
9330159F19Rik A G 10: 29,225,043 N471D probably benign Het
Ahctf1 A T 1: 179,795,796 F86I probably damaging Het
Alpk1 T C 3: 127,679,808 T849A probably benign Het
Arfgef1 A T 1: 10,174,142 D965E probably damaging Het
Asxl1 A G 2: 153,401,900 T1458A probably benign Het
Cdc42bpa A T 1: 180,111,784 M876L possibly damaging Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Col12a1 A T 9: 79,656,813 V1710E probably benign Het
Corin G A 5: 72,339,038 S524L probably damaging Het
Dennd2c A G 3: 103,156,842 H658R probably damaging Het
Disp3 A G 4: 148,258,795 V553A probably damaging Het
Dpm2 T C 2: 32,572,445 F81S probably benign Het
Emc2 T A 15: 43,513,758 I239N probably damaging Het
Fam160a1 C T 3: 85,676,097 W464* probably null Het
Fzd5 C T 1: 64,734,907 G565D probably damaging Het
Gpld1 T C 13: 24,962,856 F267S probably benign Het
Kif14 C A 1: 136,479,845 A46E probably damaging Het
Mta3 G T 17: 83,784,301 E179* probably null Het
Ninl T G 2: 150,980,117 T22P probably damaging Het
Pcnx2 T C 8: 125,753,451 N2039S probably damaging Het
Rc3h2 A G 2: 37,379,001 S818P possibly damaging Het
Scn11a T A 9: 119,813,186 E162D probably benign Het
Sptb C T 12: 76,621,161 V721M probably damaging Het
Vmn1r82 T A 7: 12,305,055 V85E probably damaging Het
Vmn2r93 T A 17: 18,298,403 F41L probably benign Het
Vmn2r-ps130 T C 17: 23,061,506 I47T possibly damaging Het
Other mutations in Slc5a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Slc5a7 APN 17 54292960 missense probably benign 0.00
IGL01833:Slc5a7 APN 17 54281833 missense probably damaging 1.00
IGL02206:Slc5a7 APN 17 54296994 missense probably damaging 0.98
IGL02493:Slc5a7 APN 17 54293880 missense probably damaging 1.00
IGL02598:Slc5a7 APN 17 54284193 missense probably benign
IGL02693:Slc5a7 APN 17 54276919 missense probably benign 0.00
IGL02896:Slc5a7 APN 17 54293017 nonsense probably null
R0288:Slc5a7 UTSW 17 54293018 nonsense probably null
R1137:Slc5a7 UTSW 17 54293011 missense probably damaging 1.00
R1692:Slc5a7 UTSW 17 54281726 missense probably damaging 0.99
R1755:Slc5a7 UTSW 17 54292978 missense probably benign 0.01
R1987:Slc5a7 UTSW 17 54293835 missense probably damaging 1.00
R4170:Slc5a7 UTSW 17 54276858 missense probably benign 0.08
R4614:Slc5a7 UTSW 17 54276559 missense probably benign 0.00
R4785:Slc5a7 UTSW 17 54278700 missense probably damaging 1.00
R4793:Slc5a7 UTSW 17 54281794 missense possibly damaging 0.95
R4828:Slc5a7 UTSW 17 54276799 missense probably benign 0.11
R4847:Slc5a7 UTSW 17 54277140 missense possibly damaging 0.82
R4879:Slc5a7 UTSW 17 54276651 missense probably benign 0.04
R5152:Slc5a7 UTSW 17 54278833 missense possibly damaging 0.51
R5171:Slc5a7 UTSW 17 54276676 missense probably benign
R5196:Slc5a7 UTSW 17 54281722 critical splice donor site probably null
R5935:Slc5a7 UTSW 17 54276944 nonsense probably null
R6307:Slc5a7 UTSW 17 54276978 missense probably benign 0.12
R6354:Slc5a7 UTSW 17 54277033 missense probably damaging 1.00
R6357:Slc5a7 UTSW 17 54287361 missense probably benign 0.16
R6395:Slc5a7 UTSW 17 54278821 missense probably damaging 1.00
R6500:Slc5a7 UTSW 17 54284203 missense probably benign
R6643:Slc5a7 UTSW 17 54276616 missense probably benign 0.00
R7062:Slc5a7 UTSW 17 54293001 missense probably damaging 1.00
R7405:Slc5a7 UTSW 17 54297133 missense probably benign
R7470:Slc5a7 UTSW 17 54276962 nonsense probably null
R7477:Slc5a7 UTSW 17 54281759 missense probably damaging 1.00
R7942:Slc5a7 UTSW 17 54276681 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ACTGCCCCATAAGTGTTGGTTC -3'
(R):5'- CCCCTGTACATTCAGAACAAGG -3'

Sequencing Primer
(F):5'- GGTTCCTTTGATGAAGAGTACACAG -3'
(R):5'- TGGTAACCATAAGCCTTTGTACAC -3'
Posted On2014-11-11