Mutagenetix > Incidental Mutation

Incidental Mutation 'R2449:Cd83'

248950

Institutional Source

Beutler Lab

Gene Symbol

Cd83

Ensembl Gene

ENSMUSG00000015396

Gene Name

CD83 antigen

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2449 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43938588-43956609 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43951132 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 95 (T95S)

Ref Sequence

ENSEMBL: ENSMUSP00000015540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015540]

AlphaFold

O88324

Predicted Effect

probably damaging
Transcript: ENSMUST00000015540
AA Change: T95S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000015540
Gene: ENSMUSG00000015396
AA Change: T95S

Domain	Start	End	E-Value	Type
IG	22	118	5.37e-4	SMART
transmembrane domain	137	159	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221359

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein and member of the immunoglobulin superfamily of receptors. The encoded protein may be involved in the regulation of antigen presentation. A soluble form of this protein can bind to dendritic cells and inhibit their maturation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice lacking this gene develop, thrive, and reproduce normally, but exhibit defects in T cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,211,320 (GRCm39)	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,211,321 (GRCm39)	E685V	possibly damaging	Het
Cdc27	T	C	11: 104,396,464 (GRCm39)	D819G	probably benign	Het
Hey2	A	T	10: 30,716,442 (GRCm39)	I64K	possibly damaging	Het
Il10rb	A	G	16: 91,208,791 (GRCm39)	H67R	probably benign	Het
Itgav	T	A	2: 83,599,094 (GRCm39)		probably null	Het
Lhx1	G	A	11: 84,412,564 (GRCm39)	R119C	probably damaging	Het
Ltbp3	G	A	19: 5,804,050 (GRCm39)	R854Q	probably benign	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Or12j2	A	T	7: 139,916,345 (GRCm39)	Q190L	probably benign	Het
Siglec1	T	C	2: 130,920,645 (GRCm39)	T720A	probably benign	Het
Sycp1	T	C	3: 102,832,522 (GRCm39)	I215V	probably benign	Het
Trim63	A	G	4: 134,050,418 (GRCm39)	E234G	probably damaging	Het
Vmn2r56	C	T	7: 12,428,082 (GRCm39)	S728N	possibly damaging	Het
Wdr64	A	T	1: 175,526,479 (GRCm39)	I43L	probably benign	Het
Wsb1	T	C	11: 79,131,178 (GRCm39)	K406R	probably benign	Het

Other mutations in Cd83

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01665:Cd83	APN	13	43,955,153 (GRCm39)	missense	probably benign	0.41
IGL02802:Cd83	UTSW	13	43,953,147 (GRCm39)	missense	probably null	1.00
R0646:Cd83	UTSW	13	43,951,009 (GRCm39)	missense	probably benign	0.03
R7686:Cd83	UTSW	13	43,938,848 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGTAAAGCCCTCACGCCAG -3'
(R):5'- AATGTTGGGCAAAAGTCAGTGC -3'

Sequencing Primer
(F):5'- ACGCCAGTCTGTCAGTAATTG -3'
(R):5'- GGAATTCATTTCCGGCCACAGATG -3'

Posted On

2014-11-12