Incidental Mutation 'R2496:Olfr543'
ID251189
Institutional Source Beutler Lab
Gene Symbol Olfr543
Ensembl Gene ENSMUSG00000044814
Gene Nameolfactory receptor 543
SynonymsMOR42-2, GA_x6K02T2PBJ9-5199377-5198367
MMRRC Submission 040410-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2496 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102476579-102481679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102477147 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 241 (K241R)
Ref Sequence ENSEMBL: ENSMUSP00000151487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051201] [ENSMUST00000061482] [ENSMUST00000219647]
Predicted Effect probably benign
Transcript: ENSMUST00000051201
SMART Domains Protein: ENSMUSP00000051280
Gene: ENSMUSG00000043925

DomainStartEndE-ValueType
Pfam:7tm_4 35 314 1.2e-73 PFAM
Pfam:7TM_GPCR_Srsx 39 311 6.3e-8 PFAM
Pfam:7tm_1 45 296 2.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061482
AA Change: K241R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051348
Gene: ENSMUSG00000044814
AA Change: K241R

DomainStartEndE-ValueType
Pfam:7tm_4 36 315 1.5e-70 PFAM
Pfam:7TM_GPCR_Srsx 40 312 1.3e-8 PFAM
Pfam:7tm_1 46 332 1.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219647
AA Change: K241R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,256,491 V391A possibly damaging Het
Acan T C 7: 79,111,317 W1926R probably damaging Het
AI464131 A G 4: 41,499,165 V155A probably benign Het
Arhgef25 T C 10: 127,187,194 T106A probably benign Het
Baz1b G A 5: 135,210,775 R243Q probably damaging Het
Cdhr3 A G 12: 33,049,069 Y508H probably benign Het
Cyp2d9 T A 15: 82,452,479 W10R probably damaging Het
Dmxl1 A G 18: 49,880,791 T1549A possibly damaging Het
Dnah8 A T 17: 30,851,731 R4464W probably damaging Het
Dpp4 G A 2: 62,387,133 T40M possibly damaging Het
Dync1h1 A G 12: 110,641,220 H2723R possibly damaging Het
E2f3 C T 13: 29,911,306 S333N probably damaging Het
Fam120a G T 13: 48,967,593 A79E probably damaging Het
Fat3 A G 9: 15,966,103 S3405P probably benign Het
Gaa T C 11: 119,283,705 S793P possibly damaging Het
Galc A C 12: 98,227,281 F350V probably damaging Het
Gm136 A G 4: 34,746,541 C157R probably damaging Het
Gm3327 A C 14: 44,126,263 N108T unknown Het
H2-M10.2 A G 17: 36,285,879 Y102H possibly damaging Het
Hmcn1 A T 1: 150,615,221 D4192E probably benign Het
Hpse2 A C 19: 43,013,043 probably null Het
Idh3a T C 9: 54,603,349 V362A probably benign Het
Kdm7a A T 6: 39,170,763 probably null Het
Krt6b A G 15: 101,679,781 V148A probably damaging Het
Lrba G A 3: 86,532,087 R1977H probably damaging Het
Magi2 A T 5: 19,678,752 Y134F probably benign Het
Mamdc4 T C 2: 25,565,902 Y801C probably damaging Het
Maml1 T C 11: 50,258,544 T790A probably benign Het
Map3k19 A G 1: 127,823,086 Y843H probably damaging Het
Mdfic A T 6: 15,741,042 H45L possibly damaging Het
Mlx C T 11: 101,088,254 T87I probably benign Het
Mms22l T A 4: 24,521,269 I382K probably benign Het
Mtf1 A G 4: 124,838,904 N585S probably benign Het
Mylk2 C T 2: 152,913,668 P251S probably damaging Het
Nox4 A T 7: 87,306,750 T157S probably benign Het
Oas2 A T 5: 120,748,617 H161Q probably benign Het
Obscn A T 11: 59,103,442 V1563E probably damaging Het
Olfr133 T C 17: 38,149,431 V281A possibly damaging Het
Olfr772 A C 10: 129,174,097 F308C probably benign Het
Pcdhb11 T A 18: 37,422,322 I235N probably benign Het
Pcsk5 A T 19: 17,466,158 C1212* probably null Het
Ptges C T 2: 30,892,710 G110D possibly damaging Het
Rsph4a A T 10: 33,908,098 I239L possibly damaging Het
Setx A G 2: 29,144,801 I433V probably benign Het
Smyd4 T C 11: 75,391,101 S467P probably benign Het
Snai2 A T 16: 14,706,002 H10L possibly damaging Het
Snw1 T C 12: 87,450,819 I467V probably benign Het
Stab1 A T 14: 31,161,463 C301S probably damaging Het
Tax1bp1 T A 6: 52,758,357 probably null Het
Tmem70 C A 1: 16,665,351 P15Q probably benign Het
Tmem87a T C 2: 120,394,378 E134G probably damaging Het
Ubr4 C T 4: 139,473,205 probably benign Het
Ugt2b37 C T 5: 87,254,710 V21M probably damaging Het
Ugt2b38 T A 5: 87,421,692 I259F probably damaging Het
Zfp804a T A 2: 82,235,844 L53Q probably damaging Het
Other mutations in Olfr543
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Olfr543 APN 7 102477166 missense possibly damaging 0.57
IGL02074:Olfr543 APN 7 102477472 missense probably benign 0.13
IGL02104:Olfr543 APN 7 102477337 missense probably damaging 1.00
IGL02124:Olfr543 APN 7 102477535 missense possibly damaging 0.63
R0014:Olfr543 UTSW 7 102477477 missense probably damaging 1.00
R1694:Olfr543 UTSW 7 102477340 missense probably benign 0.11
R1826:Olfr543 UTSW 7 102477513 missense probably damaging 1.00
R1827:Olfr543 UTSW 7 102477513 missense probably damaging 1.00
R1828:Olfr543 UTSW 7 102477513 missense probably damaging 1.00
R5117:Olfr543 UTSW 7 102477502 missense probably damaging 1.00
R5859:Olfr543 UTSW 7 102477750 missense possibly damaging 0.89
R6344:Olfr543 UTSW 7 102477531 missense probably damaging 1.00
R7031:Olfr543 UTSW 7 102477850 missense probably benign 0.03
R7426:Olfr543 UTSW 7 102477676 missense probably damaging 1.00
R7521:Olfr543 UTSW 7 102477195 missense possibly damaging 0.75
R7621:Olfr543 UTSW 7 102477265 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATGTGTTGCCGGATCTCCTTAG -3'
(R):5'- TGCAAGACATCCGTCATAAGAC -3'

Sequencing Primer
(F):5'- CCTTAGTTCTCACCCCATAAATGAG -3'
(R):5'- GTCATAAGACACTTCACCTGCGAG -3'
Posted On2014-12-04