Incidental Mutation 'R2999:Ppp1cc'
ID257229
Institutional Source Beutler Lab
Gene Symbol Ppp1cc
Ensembl Gene ENSMUSG00000004455
Gene Nameprotein phosphatase 1, catalytic subunit, gamma isoform
SynonymsPP1C gamma, PP1C gamma 2, PP1C gamma 1, PP1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2999 (G1)
Quality Score214
Status Not validated
Chromosome5
Chromosomal Location122158278-122175273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122174088 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 306 (A306T)
Ref Sequence ENSEMBL: ENSMUSP00000099587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086294] [ENSMUST00000102528] [ENSMUST00000128309] [ENSMUST00000132555]
Predicted Effect probably benign
Transcript: ENSMUST00000086294
AA Change: A306T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083474
Gene: ENSMUSG00000004455
AA Change: A306T

DomainStartEndE-ValueType
PP2Ac 30 300 6.44e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102528
AA Change: A306T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099587
Gene: ENSMUSG00000004455
AA Change: A306T

DomainStartEndE-ValueType
PP2Ac 30 300 6.44e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128309
SMART Domains Protein: ENSMUSP00000142415
Gene: ENSMUSG00000004455

DomainStartEndE-ValueType
PP2Ac 30 272 1.5e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132555
SMART Domains Protein: ENSMUSP00000143509
Gene: ENSMUSG00000004455

DomainStartEndE-ValueType
PP2Ac 30 272 1.5e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133568
Predicted Effect probably benign
Transcript: ENSMUST00000134719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142562
Predicted Effect probably benign
Transcript: ENSMUST00000151184
Predicted Effect
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to severely impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cacna1a T C 8: 84,567,742 L1178P probably damaging Het
Ccdc162 T C 10: 41,580,290 M1619V probably benign Het
Diaph3 C T 14: 86,772,094 C1083Y probably damaging Het
Dyrk3 A T 1: 131,129,446 I330N probably damaging Het
Fmn1 A G 2: 113,365,094 T380A unknown Het
Inhbe T C 10: 127,351,374 T58A possibly damaging Het
Lama2 C T 10: 26,989,421 A2914T probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Sf1 C T 19: 6,374,876 probably benign Het
Tmem121b T C 6: 120,492,982 N258S possibly damaging Het
Tmem260 T A 14: 48,484,989 L327Q possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Zcchc2 A G 1: 106,030,024 M742V probably benign Het
Other mutations in Ppp1cc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02747:Ppp1cc APN 5 122174073 missense probably benign 0.02
R0524:Ppp1cc UTSW 5 122172770 nonsense probably null
R1223:Ppp1cc UTSW 5 122168214 missense probably damaging 1.00
R2926:Ppp1cc UTSW 5 122174088 missense probably benign
R4133:Ppp1cc UTSW 5 122168226 missense probably benign 0.08
R8031:Ppp1cc UTSW 5 122174088 missense probably benign
Z1088:Ppp1cc UTSW 5 122172753 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTCCACCAAAATGCTCAGGG -3'
(R):5'- TATAACCAGCAAGTGCCAGC -3'

Sequencing Primer
(F):5'- AATGCTCAGGGACCAGTCG -3'
(R):5'- AGCAAGTGCCAGCAGTAATC -3'
Posted On2015-01-11