Incidental Mutation 'R1223:Ppp1cc'
ID152796
Institutional Source Beutler Lab
Gene Symbol Ppp1cc
Ensembl Gene ENSMUSG00000004455
Gene Nameprotein phosphatase 1, catalytic subunit, gamma isoform
SynonymsPP1C gamma, PP1C gamma 2, PP1C gamma 1, PP1
MMRRC Submission 039292-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1223 (G1)
Quality Score165
Status Not validated
Chromosome5
Chromosomal Location122158278-122175273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122168214 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 32 (E32G)
Ref Sequence ENSEMBL: ENSMUSP00000143509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086294] [ENSMUST00000102528] [ENSMUST00000128309] [ENSMUST00000132555]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086294
AA Change: E32G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083474
Gene: ENSMUSG00000004455
AA Change: E32G

DomainStartEndE-ValueType
PP2Ac 30 300 6.44e-164 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102528
AA Change: E32G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099587
Gene: ENSMUSG00000004455
AA Change: E32G

DomainStartEndE-ValueType
PP2Ac 30 300 6.44e-164 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128309
AA Change: E32G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142415
Gene: ENSMUSG00000004455
AA Change: E32G

DomainStartEndE-ValueType
PP2Ac 30 272 1.5e-116 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132555
AA Change: E32G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143509
Gene: ENSMUSG00000004455
AA Change: E32G

DomainStartEndE-ValueType
PP2Ac 30 272 1.5e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133568
Predicted Effect probably benign
Transcript: ENSMUST00000134719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142562
Predicted Effect probably benign
Transcript: ENSMUST00000151184
Predicted Effect unknown
Transcript: ENSMUST00000197730
AA Change: E21G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199354
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to severely impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A T 16: 4,298,748 V873E probably damaging Het
Arl10 A G 13: 54,578,931 D174G probably damaging Het
Cd180 A T 13: 102,706,222 Y592F possibly damaging Het
Ces3a A T 8: 105,058,029 T548S probably benign Het
Chd2 T C 7: 73,484,517 E694G probably damaging Het
Commd3 T C 2: 18,674,968 Y163H probably benign Het
Cyp8b1 A G 9: 121,915,004 S421P possibly damaging Het
Cysltr2 A T 14: 73,030,099 V57E probably damaging Het
D430042O09Rik T A 7: 125,760,423 V62E possibly damaging Het
Ddx47 G A 6: 135,012,314 V34I possibly damaging Het
Dgkz T C 2: 91,939,315 probably benign Het
Dsg2 G T 18: 20,573,493 C22F probably benign Het
Gbp10 A C 5: 105,219,001 V455G probably damaging Het
Gm12185 T A 11: 48,907,276 I797F probably damaging Het
Lrrk2 A G 15: 91,673,635 E58G probably benign Het
Mrgprb1 A G 7: 48,447,687 V159A possibly damaging Het
Mybphl A G 3: 108,375,196 T182A possibly damaging Het
Olfr1154 G A 2: 87,902,819 P286S probably damaging Het
Olfr676 A T 7: 105,035,566 I123F probably benign Het
Osr1 C T 12: 9,579,699 L191F probably damaging Het
Pip4k2b G A 11: 97,718,894 R406C probably damaging Het
Plce1 C T 19: 38,702,013 L714F probably damaging Het
Plce1 T C 19: 38,767,226 F1886S probably damaging Het
Rnh1 A G 7: 141,163,207 L260P probably damaging Het
Serpinb3a T A 1: 107,047,552 N175I probably damaging Het
Sptbn5 T A 2: 120,072,044 I68F probably damaging Het
Tas1r2 A T 4: 139,660,204 T325S probably damaging Het
Tcirg1 T C 19: 3,898,733 N484S probably benign Het
Tenm3 A T 8: 48,240,396 M1833K possibly damaging Het
Thoc5 A G 11: 4,921,922 E449G probably benign Het
Usp34 A G 11: 23,446,464 probably null Het
Other mutations in Ppp1cc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02747:Ppp1cc APN 5 122174073 missense probably benign 0.02
R0524:Ppp1cc UTSW 5 122172770 nonsense probably null
R2926:Ppp1cc UTSW 5 122174088 missense probably benign
R2999:Ppp1cc UTSW 5 122174088 missense probably benign
R4133:Ppp1cc UTSW 5 122168226 missense probably benign 0.08
R8031:Ppp1cc UTSW 5 122174088 missense probably benign
Z1088:Ppp1cc UTSW 5 122172753 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGAGCTGCTGTAAAGGAGCCTAAC -3'
(R):5'- ATACCCACCTAGACTGTGCGACTC -3'

Sequencing Primer
(F):5'- CTGTAAAGGAGCCTAACATAGCTTG -3'
(R):5'- TGCTCCTACAGCAGAGTGAG -3'
Posted On2014-01-29