Incidental Mutation 'R4133:Ppp1cc'
ID314738
Institutional Source Beutler Lab
Gene Symbol Ppp1cc
Ensembl Gene ENSMUSG00000004455
Gene Nameprotein phosphatase 1, catalytic subunit, gamma isoform
SynonymsPP1C gamma, PP1C gamma 2, PP1C gamma 1, PP1
MMRRC Submission 041637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4133 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122158278-122175273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122168226 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 36 (R36Q)
Ref Sequence ENSEMBL: ENSMUSP00000143509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086294] [ENSMUST00000102528] [ENSMUST00000128309] [ENSMUST00000132555]
Predicted Effect probably benign
Transcript: ENSMUST00000086294
AA Change: R36Q

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000083474
Gene: ENSMUSG00000004455
AA Change: R36Q

DomainStartEndE-ValueType
PP2Ac 30 300 6.44e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102528
AA Change: R36Q

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099587
Gene: ENSMUSG00000004455
AA Change: R36Q

DomainStartEndE-ValueType
PP2Ac 30 300 6.44e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128309
AA Change: R36Q

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000142415
Gene: ENSMUSG00000004455
AA Change: R36Q

DomainStartEndE-ValueType
PP2Ac 30 272 1.5e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132555
AA Change: R36Q

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143509
Gene: ENSMUSG00000004455
AA Change: R36Q

DomainStartEndE-ValueType
PP2Ac 30 272 1.5e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133568
Predicted Effect probably benign
Transcript: ENSMUST00000134719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142562
Predicted Effect probably benign
Transcript: ENSMUST00000151184
Predicted Effect unknown
Transcript: ENSMUST00000197730
AA Change: R25Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199354
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (77/79)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to severely impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700036A12Rik T A 9: 60,769,998 noncoding transcript Het
Aldh3b1 A G 19: 3,920,808 I184T probably damaging Het
Arhgap42 C T 9: 9,011,299 probably benign Het
Arhgef4 A G 1: 34,806,104 D1463G probably damaging Het
Arpc5 A G 1: 152,768,871 T52A probably benign Het
Asb6 A G 2: 30,828,235 probably benign Het
Ash1l T C 3: 88,982,260 V482A probably benign Het
Bop1 T C 15: 76,454,335 N469S probably benign Het
Btaf1 T A 19: 36,961,738 N266K probably benign Het
Btla T C 16: 45,239,298 Y122H probably damaging Het
Cacna1g A G 11: 94,432,544 M1278T probably damaging Het
Cdc42bpb A G 12: 111,321,542 S524P probably benign Het
Cep78 A G 19: 15,969,155 S438P probably damaging Het
Clca4a T G 3: 144,969,352 E171D probably benign Het
Cldn6 A T 17: 23,681,493 I144F probably damaging Het
Cpd G A 11: 76,814,818 Q363* probably null Het
Cpn1 G A 19: 43,986,284 P2L possibly damaging Het
Ddx31 A G 2: 28,858,852 D264G probably damaging Het
Ddx39b C T 17: 35,253,089 S368L probably damaging Het
Ddx60 A G 8: 61,972,220 K681E probably damaging Het
Dennd1c A C 17: 57,076,980 W15G possibly damaging Het
Dgkd T G 1: 87,941,501 probably null Het
Dnah7c G T 1: 46,665,990 A2388S probably benign Het
Etv4 C A 11: 101,770,498 K442N probably damaging Het
Fam234a T C 17: 26,213,558 D539G probably damaging Het
Fam71a A T 1: 191,163,008 N479K probably benign Het
Fancm A G 12: 65,120,530 T1538A probably benign Het
Fbn2 A T 18: 58,095,962 N725K possibly damaging Het
Fcer2a T A 8: 3,691,130 N4I possibly damaging Het
Fgd5 T C 6: 92,069,437 V1229A probably damaging Het
Gm5471 A T 15: 44,971,901 noncoding transcript Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm6729 C A 10: 86,541,166 noncoding transcript Het
Hectd4 G T 5: 121,277,834 probably null Het
Hspb3 A C 13: 113,663,491 M1R probably null Het
Igkv10-95 T C 6: 68,680,617 V19A probably damaging Het
Il1rap A G 16: 26,722,886 S626G probably benign Het
Ints9 A G 14: 64,990,554 H103R probably benign Het
Itga4 T A 2: 79,322,652 D894E probably damaging Het
Khsrp T C 17: 57,025,605 H225R probably benign Het
Lama1 T C 17: 67,750,655 Y575H probably damaging Het
Lama1 A T 17: 67,812,486 I2653F probably damaging Het
Map4k5 A T 12: 69,845,723 L144Q probably damaging Het
Mcm5 A G 8: 75,115,854 Y252C probably damaging Het
Mmgt2 A G 11: 62,665,051 E75G probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Nckap5 A G 1: 126,222,706 V162A probably benign Het
Nr3c2 T C 8: 76,909,749 I493T probably damaging Het
Olfr1411 T C 1: 92,596,743 F75L probably benign Het
Olfr325 A T 11: 58,581,075 Y77F probably damaging Het
Olfr698 A C 7: 106,753,079 L103R probably damaging Het
Papola A G 12: 105,799,658 T6A possibly damaging Het
Ptpro G T 6: 137,420,372 W81C probably damaging Het
Rasgrf2 A G 13: 91,982,654 S162P possibly damaging Het
Rpusd2 T C 2: 119,038,715 S540P probably damaging Het
Scn5a T A 9: 119,486,372 T1757S probably damaging Het
Setbp1 T C 18: 78,856,991 I1154V probably benign Het
Sirt1 T C 10: 63,335,659 I209V probably null Het
Slco6c1 T A 1: 97,081,493 I406L probably benign Het
Smc2 A G 4: 52,450,947 E255G probably damaging Het
Snap91 C A 9: 86,777,049 G477V probably damaging Het
Speg A G 1: 75,427,904 Q2780R probably benign Het
Ssh2 A G 11: 77,421,269 Y196C probably damaging Het
Ssxb9 A T X: 8,369,606 T18S probably damaging Het
Stxbp5l T C 16: 37,208,119 I527M possibly damaging Het
Tex10 T C 4: 48,468,968 Y69C probably damaging Het
Theg T C 10: 79,580,050 T236A probably damaging Het
Thoc3 T C 13: 54,468,548 D87G probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trps1 T C 15: 50,831,387 K213R probably damaging Het
Uggt1 A T 1: 36,158,159 L1221Q probably damaging Het
Vmn2r3 T A 3: 64,275,717 Y187F probably damaging Het
Washc2 G A 6: 116,258,930 E1121K probably damaging Het
Zfx T C X: 94,080,858 N360D probably damaging Het
Znhit3 A G 11: 84,916,313 V10A probably benign Het
Other mutations in Ppp1cc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02747:Ppp1cc APN 5 122174073 missense probably benign 0.02
R0524:Ppp1cc UTSW 5 122172770 nonsense probably null
R1223:Ppp1cc UTSW 5 122168214 missense probably damaging 1.00
R2926:Ppp1cc UTSW 5 122174088 missense probably benign
R2999:Ppp1cc UTSW 5 122174088 missense probably benign
R8031:Ppp1cc UTSW 5 122174088 missense probably benign
Z1088:Ppp1cc UTSW 5 122172753 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTTGGCCAGAAGCTACAAGC -3'
(R):5'- TAGAGGACGGTCTGTACCTG -3'

Sequencing Primer
(F):5'- AGCAGTAATTAGTTAGCTGCTTGCC -3'
(R):5'- TCCTACAGCAGAGTGAGCC -3'
Posted On2015-05-14