Incidental Mutation 'R2985:Mfsd13a'
ID257793
Institutional Source Beutler Lab
Gene Symbol Mfsd13a
Ensembl Gene ENSMUSG00000025227
Gene Namemajor facilitator superfamily domain containing 13a
Synonyms4930538D17Rik, Tmem180, 4930449A08Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R2985 (G1)
Quality Score198
Status Not validated
Chromosome19
Chromosomal Location46341121-46375252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46371992 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 328 (R328C)
Ref Sequence ENSEMBL: ENSMUSP00000119072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040270] [ENSMUST00000086969] [ENSMUST00000128041] [ENSMUST00000128455] [ENSMUST00000142994]
Predicted Effect probably benign
Transcript: ENSMUST00000040270
SMART Domains Protein: ENSMUSP00000039844
Gene: ENSMUSG00000025228

DomainStartEndE-ValueType
ACTIN 9 376 4.18e-203 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086969
AA Change: R328C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084189
Gene: ENSMUSG00000025227
AA Change: R328C

DomainStartEndE-ValueType
Pfam:MFS_2 15 441 6.2e-23 PFAM
low complexity region 453 463 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128041
AA Change: R328C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119072
Gene: ENSMUSG00000025227
AA Change: R328C

DomainStartEndE-ValueType
Pfam:MFS_2 9 441 1.1e-26 PFAM
low complexity region 453 463 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137143
Predicted Effect probably benign
Transcript: ENSMUST00000142994
SMART Domains Protein: ENSMUSP00000122944
Gene: ENSMUSG00000025227

DomainStartEndE-ValueType
Pfam:MFS_2 8 318 7.8e-17 PFAM
Meta Mutation Damage Score 0.3030 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ccdc83 A G 7: 90,236,367 probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cul1 T A 6: 47,502,507 F236I probably damaging Het
Etl4 T C 2: 20,781,849 V470A probably damaging Het
Fndc1 T C 17: 7,756,323 E1428G possibly damaging Het
Gal3st1 A G 11: 3,998,618 Y275C probably damaging Het
Jakmip2 G A 18: 43,571,181 T366I possibly damaging Het
Obscn A G 11: 59,133,089 F585S probably damaging Het
Olfr923 G A 9: 38,828,110 V140I probably benign Het
Oxld1 T C 11: 120,457,036 T112A probably benign Het
Pcdha9 A G 18: 36,998,202 N108S possibly damaging Het
Pkd1l2 T C 8: 117,065,551 S501G probably benign Het
Pls1 G A 9: 95,785,582 T91M possibly damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Trpm5 G T 7: 143,082,938 L421I probably damaging Het
Ttn A T 2: 76,744,274 V25425E probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Other mutations in Mfsd13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Mfsd13a APN 19 46366519 missense probably damaging 1.00
IGL01380:Mfsd13a APN 19 46367908 missense probably damaging 1.00
IGL01773:Mfsd13a APN 19 46369294 missense possibly damaging 0.60
IGL02458:Mfsd13a APN 19 46372247 missense probably damaging 1.00
IGL02955:Mfsd13a APN 19 46367753 missense possibly damaging 0.81
R0057:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0113:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0114:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0115:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0361:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0656:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1174:Mfsd13a UTSW 19 46374686 missense probably benign 0.13
R1210:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1251:Mfsd13a UTSW 19 46372053 missense probably damaging 1.00
R1364:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1365:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1366:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1367:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1692:Mfsd13a UTSW 19 46372076 missense probably benign 0.00
R1852:Mfsd13a UTSW 19 46372180 critical splice acceptor site probably null
R1968:Mfsd13a UTSW 19 46372053 missense probably damaging 1.00
R2846:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3415:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3416:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3431:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3432:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3735:Mfsd13a UTSW 19 46368328 missense probably damaging 1.00
R4393:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4394:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4396:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4920:Mfsd13a UTSW 19 46367216 missense probably damaging 1.00
R5289:Mfsd13a UTSW 19 46368280 missense probably benign 0.00
R5806:Mfsd13a UTSW 19 46366410 missense probably benign 0.01
R6153:Mfsd13a UTSW 19 46367882 missense probably damaging 1.00
R6514:Mfsd13a UTSW 19 46374625 unclassified probably null
R6558:Mfsd13a UTSW 19 46366478 missense probably damaging 1.00
R6649:Mfsd13a UTSW 19 46367866 missense probably damaging 0.99
R6649:Mfsd13a UTSW 19 46372265 missense probably benign
R6653:Mfsd13a UTSW 19 46367866 missense probably damaging 0.99
R6911:Mfsd13a UTSW 19 46369277 missense probably damaging 1.00
R7022:Mfsd13a UTSW 19 46368324 nonsense probably null
R7334:Mfsd13a UTSW 19 46368370 missense probably damaging 1.00
R7525:Mfsd13a UTSW 19 46369277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACATTGTCTGTTGGCAATGAATG -3'
(R):5'- TCAGCAGCTTACAGGTACCC -3'

Sequencing Primer
(F):5'- TGCAAACTGACCCCGATTATTAC -3'
(R):5'- GCTTACAGGTACCCTCAGTGAAG -3'
Posted On2015-01-11