Incidental Mutation 'R3416:Mfsd13a'
ID266820
Institutional Source Beutler Lab
Gene Symbol Mfsd13a
Ensembl Gene ENSMUSG00000025227
Gene Namemajor facilitator superfamily domain containing 13a
Synonyms4930538D17Rik, Tmem180, 4930449A08Rik
MMRRC Submission 040634-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R3416 (G1)
Quality Score203
Status Validated
Chromosome19
Chromosomal Location46341121-46375252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46371992 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 328 (R328C)
Ref Sequence ENSEMBL: ENSMUSP00000119072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040270] [ENSMUST00000086969] [ENSMUST00000128041] [ENSMUST00000128455] [ENSMUST00000142994]
Predicted Effect probably benign
Transcript: ENSMUST00000040270
SMART Domains Protein: ENSMUSP00000039844
Gene: ENSMUSG00000025228

DomainStartEndE-ValueType
ACTIN 9 376 4.18e-203 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086969
AA Change: R328C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084189
Gene: ENSMUSG00000025227
AA Change: R328C

DomainStartEndE-ValueType
Pfam:MFS_2 15 441 6.2e-23 PFAM
low complexity region 453 463 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128041
AA Change: R328C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119072
Gene: ENSMUSG00000025227
AA Change: R328C

DomainStartEndE-ValueType
Pfam:MFS_2 9 441 1.1e-26 PFAM
low complexity region 453 463 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137143
Predicted Effect probably benign
Transcript: ENSMUST00000142994
SMART Domains Protein: ENSMUSP00000122944
Gene: ENSMUSG00000025227

DomainStartEndE-ValueType
Pfam:MFS_2 8 318 7.8e-17 PFAM
Meta Mutation Damage Score 0.3030 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500009L16Rik T C 10: 83,759,632 probably null Het
Abi1 T C 2: 23,040,002 S22G probably damaging Het
Adgrl2 T C 3: 148,859,329 Y201C probably damaging Het
Adnp2 T C 18: 80,128,158 E1012G possibly damaging Het
Azin1 A T 15: 38,493,546 S278T possibly damaging Het
Crocc G A 4: 141,046,447 T103I possibly damaging Het
Cyb561d2 A G 9: 107,540,126 L142P probably damaging Het
Cyhr1 A T 15: 76,658,715 probably null Het
Cyp4f39 T C 17: 32,489,742 V421A possibly damaging Het
Fryl T C 5: 73,108,074 Q510R possibly damaging Het
Gfra1 T C 19: 58,267,112 Y301C probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klhl42 G A 6: 147,107,880 V406M probably damaging Het
Mycs C T X: 5,468,756 S90N possibly damaging Het
Olfr508 G A 7: 108,630,018 V9I possibly damaging Het
Pcdha8 A T 18: 36,992,630 Q55L probably benign Het
Pkhd1l1 A G 15: 44,547,364 T2756A probably damaging Het
Prl8a8 A T 13: 27,511,549 C71S probably damaging Het
Ralgapa1 T A 12: 55,770,613 probably benign Het
Rtl4 C T X: 145,119,905 Q108* probably null Het
Scn4a A T 11: 106,330,413 S807T probably benign Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Smg1 G C 7: 118,148,853 probably benign Het
Spata1 A T 3: 146,487,508 probably benign Het
Strbp C G 2: 37,590,725 R610T possibly damaging Het
Susd5 A G 9: 114,095,658 D203G possibly damaging Het
Tas2r124 A T 6: 132,755,638 R303S probably benign Het
Tgm3 G A 2: 130,047,772 V629M possibly damaging Het
Tha1 T C 11: 117,873,200 D67G possibly damaging Het
Vmn2r120 T A 17: 57,509,241 I705F possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zan T A 5: 137,435,720 E2250D unknown Het
Zfp560 A T 9: 20,347,678 Y629* probably null Het
Other mutations in Mfsd13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Mfsd13a APN 19 46366519 missense probably damaging 1.00
IGL01380:Mfsd13a APN 19 46367908 missense probably damaging 1.00
IGL01773:Mfsd13a APN 19 46369294 missense possibly damaging 0.60
IGL02458:Mfsd13a APN 19 46372247 missense probably damaging 1.00
IGL02955:Mfsd13a APN 19 46367753 missense possibly damaging 0.81
R0057:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0113:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0114:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0115:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0361:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0656:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1174:Mfsd13a UTSW 19 46374686 missense probably benign 0.13
R1210:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1251:Mfsd13a UTSW 19 46372053 missense probably damaging 1.00
R1364:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1365:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1366:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1367:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1692:Mfsd13a UTSW 19 46372076 missense probably benign 0.00
R1852:Mfsd13a UTSW 19 46372180 critical splice acceptor site probably null
R1968:Mfsd13a UTSW 19 46372053 missense probably damaging 1.00
R2846:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R2985:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3415:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3431:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3432:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3735:Mfsd13a UTSW 19 46368328 missense probably damaging 1.00
R4393:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4394:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4396:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4920:Mfsd13a UTSW 19 46367216 missense probably damaging 1.00
R5289:Mfsd13a UTSW 19 46368280 missense probably benign 0.00
R5806:Mfsd13a UTSW 19 46366410 missense probably benign 0.01
R6153:Mfsd13a UTSW 19 46367882 missense probably damaging 1.00
R6514:Mfsd13a UTSW 19 46374625 unclassified probably null
R6558:Mfsd13a UTSW 19 46366478 missense probably damaging 1.00
R6649:Mfsd13a UTSW 19 46367866 missense probably damaging 0.99
R6649:Mfsd13a UTSW 19 46372265 missense probably benign
R6653:Mfsd13a UTSW 19 46367866 missense probably damaging 0.99
R6911:Mfsd13a UTSW 19 46369277 missense probably damaging 1.00
R7022:Mfsd13a UTSW 19 46368324 nonsense probably null
R7334:Mfsd13a UTSW 19 46368370 missense probably damaging 1.00
R7525:Mfsd13a UTSW 19 46369277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGACATTGTCTGTTGGCAATG -3'
(R):5'- CAGCTTACAGGTACCCTCAGTG -3'

Sequencing Primer
(F):5'- ACATTGTCTGTTGGCAATGAATGC -3'
(R):5'- TGAAGACACGGTTGCTGC -3'
Posted On2015-02-18